| Gene | Function |
|---|---|
| leuS | Leucyl-tRNA synthetase |
| pgi | Phosphoglucose isomerase |
| pgk | Phosphoglycerate kinase |
| phoE | Phosphoporine E |
| pyrG | CTP synthase |
| rpoB | β-subunit of RNA polymerase B |
| fusA | Elongation factor G |
MLST Protocol for Klebsiella variicola
Primary Reference
Molecular epidemiology of Klebsiella variicola obtained from different sources
MLST Gene Targets
PCR Amplification Protocol
| Gene | Primer | Sequence (5'-3') | Temp (°C) | Size (bp) |
|---|---|---|---|---|
| leuS | F | GGCGTTGATATTGGCGATGG | 60 | 933 |
| leuS | R | GCCGCCGCCGCCGCCGCCAA | 60 | 933 |
| pgi | F | ATGGCTAAACTGGGTAAAGGTG | 60 | 801 |
| pgi | R | TTACGCCTGAACTGCTTGCC | 60 | 801 |
| pgk | F | ATGAAAAAATTATTGATTTTATTG | 55 | 1242 |
| pgk | R | TTATTTTTTCCGCCCTTCAC | 55 | 1242 |
| phoE | F | ATGAAAGTTTTAGTTATTATTG | 55 | 906 |
| phoE | R | TTATTTTTTAGCGCCGTTTC | 55 | 906 |
| pyrG | F | ATGGCGAAAGTTATTGTTG | 55 | 1095 |
| pyrG | R | TTATTTGCCGCCGCCGCCAA | 55 | 1095 |
| rpoB | F | ATGTCGCGTATTGAAGGTG | 60 | 903 |
| rpoB | R | TTACGCCTTGTTGCCGCCG | 60 | 903 |
| fusA | F | ATGGCGAAAGTTATTGTTG | 60 | 1458 |
| fusA | R | TTACTCGCCGCCGCCGCCAA | 60 | 1458 |
Allele Sequences
Reference Allele Sequences
Allelic profile of K. variicola 801 (GenBank: CDMV01000001):
leuS (594 bp)
pgi (600 bp)
pgk (444 bp)
phoE (453 bp)
pyrG (522 bp)
rpoB (513 bp)
fusA (561 bp)
Sequence Analysis Guidelines
Sequence Type Assignment
This page was designed for assignation of sequence type (ST) for K. variicola isolates, using data for both Sanger and whole genome sequencing technologies.
For Whole Genome Sequencing (WSG)
For WGS we included, first, the ANI (average nucleotide identity; see references below) analysis for proper identification of bacterial species among the Klebsiella pneumoniae species complex (KpSC), using the following genomes as references:
- Klebsiella variicola Reference Strain F2R9 (DSM 15968, ATCC BAA-830) (CP072130)
- Klebsiella pneumoniae (ATCC 700721, MGH 78578) (CP000647)
- Klebsiella quasipneumoniae ATCC 700603 (CP014696)
- Klebsiella quasivariicola KPN1705 (CP022823) (this last recently described)
- Klebsiella africana SB5857 (GCF_900978845.1)
- Klebsiella variicola subs tropica SB94 (GCF_900978435.1)
Only for K. variicola genomes the ST will be determined.
Key References
DNA-DNA hybridization values and their relationship to whole-genome sequence similarities
Int J Syst Evol Microbiol 57:81-91. 10.1099/ijs.0.64483-0
Taxonomic affiliation of new genomes should be verified using average nucleotide identity and multilocus phylogenetic analysis
Genome Announc. 4;2. pii: e00927-14. doi: 10.1128/genomeA.00927-14
Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans
Salud Publica de Mexico. 2018. 60;1:56-62.