Allelic profile:

leuS pgi pgk phoE pyrG rpoB fusA


Which ST profile has your sequence?, Select your fasta file:


Run average nucleotide identity (ANI)


Enter Query Sequence:




Database developed by the Centro de Investigación Sobre Enfermedades Infecciosas (CISEI) in collaboration with the Centro de Ciencias Genómicas (CCG-UNAM). This site has been funded by the Instituto Nacional de Salud Pública (INSP).

Reference for citations of MLST of K. variicola:
Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises. Molecular epidemiology of Klebsiella variicola obtained from different sources. Scientific Reports. 2019. 9:10610. Download

Reference for citations of MLST of K. variicola:

Molecular epidemiology of Klebsiella variicola obtained from different sources.
Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises.
Scientific Reports. 2019.
Download

Protocol used for MLST of Klebsiella variicola.

Genes of MLST:
leuS(Leucyl-tRNA synthethase)
pgi(Phosphoglucose iomerase)
pgk(Phosphoglycerate kinase)
phoE(Phosphoporine E)
pyrG(CTP synthase)
rpoB(β-subunit of RNA polymerase B)
fusA(Elongation factor G)

PCR Amplification:
444
Gene/primerSequence (5’-3’)Annealing (Tm)Size (bp)Amplification Product (bp)
leuSKv-FCGAACAGGTTATCGACGGCT63 °C594968
leuSKv-RCAAAGGTGTCGGTTTCACGC
pgiKv-FAAAGAGACCGATCTGGCAGG60 °C600760
pgiKv-RACCAGATACCGATCAGCGCC
pgkKv-FTCGTGATGGATGCTTTCGGT63 °C594663
pgkKv-RAGATTTTGTCAGCGATGCCG
phoEKv-FCTGTACGACGTGGAAGCCTG63 °C453613
phoEKv-RCCACGAAGGCGTTCATGTTT
pyrGKv-FCCGATCGCTATGGTCGCTG60 °C522664
pyrGKv-RCGGGACATCAGTTCCGGGT
rpoBKv-FGCCAGCTGTCCCAGTTTATG60 °C513648
rpoBKv-RGAACGGTACCGCCACGTTTA
fusAKv-FCGAAAACCAAAGCTGACCAGG62 °C561782
fusAKv-RCATGGTGTATGATGCACGACCT

Conditions of amplification:

PCR: 3 min at 96°C; 30 cycles of 1 min at 95°C; 30 seg annealing temperature (60°C to 63°C according of amplification gene); 1 min at 72°C. Following 7 min at 72°C.

PCR reaction:
Each reaction contains 10ng of chromosomal DNA, 12.5 pmol of each primer, 25mM of the dNPTs, 1X of PCR Buffer, 1 unit of Taq polymerase and water to 50 ml.

Sequencing of PCR products:
The primer used by PCR amplification were used by Sanger sequencing step

Allele template. Allelic profile of K. variicola 801 (GenBank: CDMV01000001):
leuS (594 bp)
GATCACTGGCCAGACACCGTAAAGACCATGCAGCGCAACTGGATCGGCCGTTCCGAAGGG
GTGGAAATCTCCTTTGACGTCAACAACTACGCCGATAAGCTGACCGTCTACACCACCCGT
CCGGACACCTTTATGGGCTGCACCTACCTGGCTGTCGCGGCGGGTCACCCGCTGGCGCAG
CAGGCTGCAGCGAACAATCCGGCGCTGGCTGCCTTTATCGACGAATGCCGTAATACCAAA
GTAGCCGAAGCCGACATGGCGACGATGGAGAAAAAAGGCGTCGATACCGGGTTTAAAGCC
ATTCACCCGCTGACCGGCGAAGAAATTCCTGTCTGGGCGGCAAACTTCGTGCTGATGGAA
TATGGCACCGGCGCGGTCATGGCCGTTCCGGGTCACGACCAGCGTGACTATGAGTTCGCC
AGCAAGTACGGTCTGAACATCAAGCCGGTTATCCTCGCCGCTGACGGCAGCGAGCCGGAT
CTCTCCGCGCAGGCGCTGACCGAGAAAGGCGTCCTGTTTAACTCCGGCGAGTTCAGCGGC
CTCGATTATGAAGCCGGCTTCAACGCCATTGCCGACAAACTGGCAGCCATGGGC

pgi (600 bp)
GACCGTGCGGTACTGCACGTCGCGCTGCGCAACCGCAGCAATACGCCGATTGTGGTTGAT
GGCAAAGATGTGATGCCGGAAGTGAACGCTGTGCTGGAGAAGATGAAAACCTTCTCAGAA
GCGATTATCTCCGGTAGCTGGAAAGGCTATACCGGCAAACCGATCACCGACGTGGTTAAC
ATTGGTATCGGCGGTTCCGACCTCGGTCCGTTCATGGTCACCGAAGCGCTGCGTCCGTAC
AAAAACCACCTCAACATGCACTTTGTCTCCAACGTCGATGGCACCCACATCGCTGAAGTG
CTGAAGAACGTCAACCCGGAAACGACCCTGTTCCTGGTGGCGTCCAAGACCTTCACCACT
CAGGAAACCATGACCAACGCCCACAGCGCGCGCGACTGGTTCCTGGCGACCGCGGGCGAC
GACAAACACGTGGCCAAACACTTCGCGGCGCTTTCTACCAACGCGAAAGCGGTTGGCGAG
TTCGGCATCGACACCGCCAACATGTTTGAATTCTGGGACTGGGTTGGCGGCCGTTACTCC
CTGTGGTCGGCGATTGGCCTGTCCATCATTCTCTCCGTGGGCTTCGACAACTTCGTTGAG

pgk (444 bp)
GCGTGCGCAGGCCCGCTGCTGGCCGCTGAACTGGACGCGCTGGGTAAAGCGCTGAAAGAG
CCGGCTCGTCCGATGGTCGCTATCGTGGGTGGTTCTAAAGTGTCCACCAAACTGACCGTG
CTGGATTCCCTGTCTAAAATCGCTGACCAGCTGATCGTCGGCGGCGGTATCGCCAACACC
TTCGTTGCTGCCCAGGGCCACAACGTCGGTAAATCCCTGTACGAAGCAGACCTGGTTGAT
GAAGCTAAGCGCCTGCTGAGCACCTGTGATATCCCGGTTCCGACGGACGTTCGCGTCGCG
ACCGAGTTCTCCGAAACCGCAACGGCAACCCTGAAATCTGTTAACGACATCAAAGATGAC
GAGCAGATTCTGGACCTTGGCGACGTTTCCGCACAGAAACTGGCCGACATCCTGAAAAAC
GCCAAAACCATCCTGTGGAACGGC

phoE (453 bp)
GATTCCTCTGCCCAGACCGATAACTTTATGACCAAACGCGCCAGCGGCCTGGCGACCTAC
CGCAATACCGATTTCTTCGGTCTGGTGGATGGTCTGGATATGACCCTGCAGTACCAGGGT
AAAAACGAAGGCCGTGAAGCGAAGAAACAGAACGGCGACGGCGTTGGCACCTCATTAAGC
TATGATTTCGGCGGCAGCGACTTCGCCGTCAGCGCGGCCTACACCAGCTCCGACCGTACC
AACGATCAGAACCTGCTGGCCCGCGGCCAGGGTTCGAAAGCGGAAGCCTGGGCGACCGGC
CTGAAATATGACGCCAACAATATCTACCTGGCGACCATGTATTCTGAGACCCGCAAAATG
ACCCCGATCAGCGGCGGTTTTGCCAACAAAGCGCAGAACTTTGAAGCGGTGGCGCAGTAT
CAGTTCGACTTCGGTCTGCGTCCGTCCCTCGGC

pyrG (522 bp)
ACGTCCTTGCGCATCGCACTGATTGGCCGTGAGTCAGACCACCGTCTGGTCTACCCCGCC
ACGCTTGGCTCACTGGGTGATGCCGCGGCGTCGCTGGGGCTGAACCTGGAGGTCCATTTC
TTCGCGCCGGTCAGTCTGTCCCCTGGGTTACACGACCTCCACGACGTCCAGGGCGTCGTG
TTGCCAGGCGGTTCCTCGATGGCCGCCGTCAAGGGACAAATCCGCGTGGCGGAAGATACG
CTTGCCCGCGGACAGCCCACGCTGGGGTTATGCCTGGGAATGCAGAGCATGATGACCGCA
GTCGTGCGCCGACGTCCGGGTTGCGAATCAGCCATTCCCGCCGAAGTGGCTCCGGATGAG
GCTCTGCACAGCTTTGTTCCCTTTGTTGATGGCCGTCATCGCTGCGGCGTATTCCCTTTT
TCCTTCGGGTTGATCCCCGGTGATATCCGCGAAATGCACTACAACCATCGCTACTGCTTT
AACACCGACTTATTACCGGCGCTGGATCGCAGCGGGGTCAGC

rpoB (513 bp)
ATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGCGCAGGCTTCGAAGTTCGAGAC
GTACACCCGACGCACTACGGTCGCGTATGTCCAATCGAAACGCCTGAAGGTCCGAACATC
GGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATACGGTTTCCTTGAGACC
CCGTATCGTAAAGTGACCGACGGTGTGGTTACCGATGAAATTCACTACCTGTCTGCTATC
GAAGAAGGCAACTACGTTATTGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCACTTC
GTAGAAGACCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAG
GTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCG
TTCCTGGAGCACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCG
GTTCCGACTCTGCGCGCTGATAAGCCGCTGGTT

fusA (561 bp)
AACCAGACCATCATCGCCGGTATGGGTGAGCTGCACCTCGACATCATCGTTGACCGTATG
AAGCGTGAATTCAACGTTGAAGCGAACGTCGGTAAACCTCAGGTTGCTTACCGTGAAGCG
ATTCGCGCGAAAGTTACCGATATCGAAGGTAAACACGCCAAGCAGTCTGGTGGTCGTGGT
CAGTACGGTCACGTTGTGATCGACATGTACCCGCTGGAGCCGGGCTCTAACCCGAAAGGT
TACGAGTTCATCAACGACATCAAAGGTGGTGTAATTCCTGGCGAATACATCCCGGCCGTT
GATAAAGGCATCCAGGAACAGCTGAAAGCTGGTCCGCTGGCAGGTTACCCGGTAGTTGAT
ATGGGTATCCGTCTGCACTTCGGTTCTTACCACGACGTTGACTCCTCTGAGCTGGCGTTT
AAACTGGCTGCGTCTATTGCCTTTAAAGAAGGCTTTAAGAAGGCAAAACCAGTTCTGCTT
GAGCCGATCATGAAGGTTGAAGTAGAAACTCCGGAAGAGAACACTGGTGATGTTATCGGT
GACTTGAGCCGTCGTCGCGGT

Sequence comparison:

This page was design for assignation of sequence type (ST) of K. variicola isolates, both for Sanger- and for whole genome-type sequencing technologies. In the case of whole genome sequencing we included, first, the ANI (average nucleotide identity; see references below) analysis for proper identification of bacterial species as: Klebsiella variicola Reference Strain F2R9 (DSM 15968, ATCC BAA-830) (CP072130), Klebsiella pneumoniae (ATCC 700721, MGH 78578) (CP000647), Klebsiella quasipneumoniae ATCC 700603 (CP014696) and Klebsiella quasivariicola KPN1705 (CP022823) (this last recently described). Only for K. variicola genomes will be determined the sequence tape (ST). In the other cases determines which of the other species corresponds to those included in the analysis.

This considering the following references:

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.
Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. 2007.
Int J Syst Evol Microbiol 57:81–91. 10.1099/ijs.0.64483-0.

Taxonomic affiliation of new genomes should be verified using average nucleotide identity and multilocus phylogenetic analysis.
Figueras MJ, Beaz-Hidalgo R, Hossain MJ, Liles MR. 2014.
Genome Announc. 4;2. pii: e00927-14. doi: 10.1128/genomeA.00927-14

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :56-62.

Download sequences and ST table:

ST table:

ST Origin Sample ESBL/Carba-
penemase		 Country Accession Strain leuS pgi pgk phoE pyrG rpoB fusA
1 Human Blood SHV-2 Mexico CDMV00000000 801 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 805 1 1 1 1 1 1 1
1 Human Blood SHV-2 Mexico 25886267 806 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 807 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 808 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 809 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 811 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 812 1 1 1 1 1 1 1
1 Human Urine Negative USA QIYN01000001.1 WUSM_KV_09 1 1 1 1 1 1 1
2 Human Sputum Negative Mexico CEGG00000000 8917 1 2 2 1 2 1 2
3 Plant Banana root Negative Mexico CXPC00000000 6A2 1 3 3 2 3 1 3
3 Human Blood Negative Italy UJZQ01000001.1 EuSCAPE_IT012 1 3 3 2 3 1 3
3 Human Blood Negative Serbia UKAM01000001.1 EuSCAPE_RS065 1 3 3 2 3 1 3
4 Human Abscess CTX-M-15 Mexico CXOZ00000000 06-268 1 1 4 2 4 2 2
5 Human Blood Negative Mexico CXPB00000000 4880 1 4 5 3 1 1 4
6 Plant Sugar cane stem Negative Mexico CXPA00000000 T29A 2 5 6 4 5 1 2
7 Insect Fungus matrix Negative Panama CP001891.1 At-22 3 1 7 1 6 3 4
8 Plant Maize stems Negative USA CP000964.1 342 1 6 8 5 7 1 5
9 Plant Banana roots Negative China CP009274 DX120E 1 6 9 1 8 1 2
10 Human Gut Negative Denmark CBBA000000000 CAG:634 1 4 10 6 9 1 2
10 Human Blood SHV-12 (LEN-type negative) China CP030173.1 13450 1 4 10 6 9 1 2
10 Human Wound swab Negative Tanzania OVDM01000001.1 KCRI-198C 1 4 10 6 9 1 2
10 Human Sputum Negative Tanzania OVDP01000001.1 KCRI-201B 1 4 10 6 9 1 2
10 Human Respiratory SHV-30 USA SRX2681986 KPN1264 1 4 10 6 9 1 2
10 Human Urine Negative USA QIXS01000001.1 WUSM_KV_30 1 4 10 6 9 1 2
10 Human Urine Negative USA QIXM01000001.1 WUSM_KV_36 1 4 10 6 9 1 2
11 plant Banana root Negative China CP010523 DSM15968 4 7 5 1 10 1 4
11 Plant Banana root Negative Mexico 15053318 F2R9 (ATCC BAA-830) 4 7 5 1 10 1 4
12 Human Faeces negative Braziil JDWA00000000 BZ19 5 8 11 1 11 1 4
13 Insect Nezara viridula (Cotton Pathogen Vector; southern green stink bug) negative USA CP008700.1 KP5-1 6 6 4 7 11 1 2
14 Human Pus CTX-M-15/KPC-6 Malaysia JRTV00000000 223/14 7 3 6 8 12 4 3
15 Plant Bitter gourd negative Malaysia JSWX00000000 B1 8 4 12 9 1 1 2
16 Plant Chili negative Malaysia JSXA00000000 CH4 9 3 12 8 3 5 2
16 Human Urine negative USA JMWB00000000 BIDMC61 9 3 12 8 3 5 2
17 Human Respiratory negative USA AYJK00000000 MGH20 1 1 1 1 4 1 2
18 missing Urine negative USA AYIX00000000 MGH40 10 9 6 1 13 1 6
19 missing missing negative USA AYIF00000000 UCICRE10 1 4 1 1 11 1 2
20 Human Urine negative USA JCML00000000 UCI18 1 10 2 10 14 1 2
20 Human missing negative USA LFAP00000000 MGH114 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDW01000001.1 ID_2 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDT01000001.1 ID_5 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDV01000001.1 ID_6 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDM01000001.1 ID_8 1 10 2 10 14 1 2
20 Human Urine negative Belgium UKAV01000001.1 EuSCAPE_BE029 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDI01000001.1 ID_11 1 10 2 10 14 1 2
20 Human Urine negative USA QIXC01000001.1 WUSM_KV_46 1 10 2 10 14 1 2
21 Human Urine negative USA JMZD00000000 MGH68 11 5 5 11 11 1 2
22 Human Urine negative USA JMZM00000000 MGH80 11 3 6 12 11 6 4
23 Human missing negative USA LFBA00000000 BIDMC88 1 11 10 6 9 1 2
24 Human missing negative USA LFBC00000000 BIDMC90 12 12 10 1 15 1 4
25 Human missing negative USA LFAD00000000 MGH92 9 13 13 13 7 1 4
26 Human missing negative USA ACXA00000000 1.1.55 9 10 13 13 7 1 4
27 Human missing negative USA ASQN00000000 KTE92 11 6 5 1 16 4 4
28 Human Blood negative Mexico 15053318 1109 1 1 4 2 17 2 2
29 Human Catheter negative Mexico 15053318 1171 1 4 3 14 18 1 3
30 Human Secretion negative Mexico 25886267 9351 1 14 5 1 19 1 4
31 Human Biliary liquids negative Mexico 25886267 9353 13 15 1 1 20 1 2
32 Human Abscess negative Mexico 25886267 9925 14 16 14 15 21 7 2
32 Human Blood negative Mexico 26571390 10239 14 16 14 15 21 7 2
32 Human Sputum negative USA JVTE01000001 1335_KPNE 14 16 14 15 21 7 2
32 Human Blood negative USA SRX2682028 KPN700 14 16 14 15 21 7 2
32 Human Other (CAPD) negative Portugal UJZY01000001.1 EuSCAPE_PT079 14 16 14 15 21 7 2
33 Plant Banana stem negative Mexico 15053318 VI 15 6 15 1 22 1 2
34 Plant Rice roots negative Mexico 15053318 CFN2006 1 3 5 16 1 8 2
35 Human Vaginal secretion negative Mexico 29692906 10447 16 1 5 1 1 1 6
36 Human missing negative Mexico This work 9271 1 4 16 2 23 9 2
37 Human missing negative Mexico This work 9274 17 17 1 1 24 1 5
37 Human Wound, drain right lower quadrant negative Mexico QIYH01000001.1 WUSM_KV_15 17 17 1 1 24 1 5
38 Human missing negative Mexico This work 11212 1 4 10 6 1 1 2
39 Human missing negative Mexico This work 11214 11 6 13 2 25 3 4
40 Human missing negative Mexico This work 11226 1 18 17 17 1 10 2
41 Human missing negative Mexico This work 11248 2 5 10 1 1 1 2
41 Environmental Soil negative Singapore CP013985.1 LMG23571 2 5 10 1 1 1 2
42 Human Sputum negative Mexico This work 11254 18 6 4 1 1 6 2
43 Human missing negative Mexico This work 11435 17 17 1 1 26 1 5
44 Human missing negative Mexico This work 11463 12 19 13 1 27 1 4
45 Human missing negative Mexico This work 11436 1 1 6 18 28 1 4
46 Plant Sugarcane rhizosphere soil negative Mexico This work KvMx3 2 5 18 19 1 1 2
47 Plant Sugarcane rhizosphere soil negative Mexico This work KvMx4 19 15 6 20 22 1 6
48 Plant Maize rhizosphere soil negative Mexico This work KvMx18 11 10 19 1 4 1 2
49 Human Sputum negative USA JVDU01000001.1 521_SSON 1 20 6 21 1 7 2
49 Human Bronchoalveolar Lavage negative USA JVDR01000001.1 524_SBOY 1 20 6 21 1 7 2
49 Human Sputum negative USA JUYL01000001.1 653_KVAR 1 20 6 21 1 7 2
50 Human Fluid negative USA JUXS01000001.1 671_KVAR 1 3 6 22 3 8 2
51 Human Tracheal Aspirate negative USA JUTF01000001.1 780_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURI01000001.1 833_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURH01000001.1 834_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURG01000001.1 835_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURF01000001.1 836_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURE01000001.1 837_KPNE 1 20 1 23 29 9 4
51 Human Urine catheter negative USA QIYM01000001.1 WUSM_KV_10 1 20 1 23 29 9 4
52 Human Urine, Catheterized negative USA JUSW01000001.1 789_KVAR 1 4 3 24 11 1 2
53 Human Body fluid KPC-2 USA PTGT01000001.1 1565/2503 1 21 1 25 30 11 4
54 Human Unknown negative Vietnam ERR025463 1892m 1 5 5 1 1 1 2
54 Human missing negative USA NGSP01000001.1 BIDMC118 1 5 5 1 1 1 2
55 Human missing negative Mexico This work 11446 20 22 20 26 31 12 7
56 Human Unknown negative Australia ERS005747 AJ026 21 18 3 2 1 13 2
56 Human Unknown negative Australia ERS005771 AJ182 21 18 3 2 1 13 2
56 Human Trach asp negative USA QIYS01000001.1 WUSM_KV_04 21 18 3 2 1 13 2
56 Human Urine negative USA QIYF01000001.1 WUSM_KV_17 21 18 3 2 1 13 2
56 Human Urine negative USA QIXD01000001.1 WUSM_KV_45 21 18 3 2 1 13 2
57 Human Unknown negative Australia ERS005754 AJ135 22 6 6 27 1 1 8
57 Human Blood CTX-M-15/OXA-1 Netherlands JXJH01000001.1 KP-21F 22 6 6 27 1 1 8
58 Human Unknown negative Australia ERS005778 AJ292 6 4 1 28 32 14 2
59 missing missing negative USA MPCI01000001.1 AR_0016 23 19 5 29 2 1 4
59 Human Urine negative USA QIXW01000001.1 WUSM_KV_26 23 19 5 29 2 1 4
60 Human Blood CTX-M-15 Bangladesh QUAA01000001.1 BD.DM.32 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZQ01000001.1 BD.DM.33 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZR01000001.1 BD.DM.97 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZS01000001.1 BD.DM.115 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh PJOO01000001.1 BD.DM.165 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZT01000001.1 BD.DM.166 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZU01000001.1 BD.DM.167 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZV01000001.1 BD.DM.169 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZW01000001.1 BD.DM.322 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZX01000001.1 BD.DM.323 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZY01000001.1 BD.DM.395 11 6 5 30 16 4 4
61 Human missing KPC-2 USA NGSO01000001.1 BIDMC117 1 9 6 1 13 1 6
61 Human Urine negative USA QIXP01000001.1 WUSM_KV_33 1 9 6 1 13 1 6
62 Plant Roots of tall fescue negative China LOAR00000000 D5A 10 9 6 1 32 1 6
62 Human Unknown negative Germany UIDS01000001.1 ID_24 10 9 6 1 32 1 6
63 Plant Roots Maize negative China NZ_CP016344.1 E57-7 9 3 12 31 3 5 2
64 Environmental river water NDM-9 South Korea NZ_CP017284.1 GJ1 1 3 6 8 11 1 9
64 Environmental river water NDM-9 South Korea NZ_CP017849.1 GJ2 1 3 6 8 11 1 9
64 Environmental river water CTX-M-65/NDM-9 South Korea NZ_CP017289.1 GJ3 1 3 6 8 11 1 9
65 Human Unknown CTX-M-148 China MOSU00000000 H39 24 3 1 32 33 15 4
65 Human Pulmonary CTX-M-24 (two copies) China CP018307 X39 24 3 1 32 33 15 4
66 Human Unknown negative Germany UIDY01000001.1 ID_16 13 23 5 33 19 1 10
66 Human Unknown negative Germany UIDU01000001.1 ID_18 13 23 5 33 19 1 10
66 Human Unknown negative Germany UIEF01000001.1 ID_19 13 23 5 33 19 1 10
67 Human Unknown negative Germany UIFG01000001.1 ID_43 13 23 5 34 19 1 10
68 Human Unknown negative Germany UIFD01000001.1 ID_49 1 18 6 1 34 13 2
68 Human Blood negative Croatia UKAN01000001.1 EuSCAPE_HR085 1 18 6 1 34 13 2
69 Human Blood DHA-1, SHV-12, CTX-M-14, KPC-2 Bangladesh NPGY01000001.1 K2631 25 21 3 35 35 1 2
70 Human Wound swab negative Tanzania OVDF01000001.1 KCRI-152E 26 10 1 36 1 13 2
71 Human Catheter KPC-2 Colombia MSZI01000001.1 KP007 9 4 6 24 1 1 2
72 Human Urine SHV-12 USA SRX2681305 KPN325 19 5 5 6 10 1 2
73 Human Blood SHV-12 USA SRX2680563 KPN458 11 9 6 20 1 13 2
73 Human Urine negative USA QIXA01000001.1 WUSM_KV_48 11 9 6 20 1 13 2
74 Human Urine CTX-M-15 USA SRX2681541 KPN807 27 4 3 1 35 1 2
75 Human Respiratory KPC-2 USA SRX2681803 KPN1401 1 1 15 1 1 11 4
75 Human Respiratory TEM-69/KPC-2 USA SRX2681790 KPN1415 1 1 15 1 1 11 4
76 Human Urine CTX-M-15/NDM-1 USA SRX2681713 KPN1481 28 24 5 37 36 1 2
77 Human Wound SHV-12 USA SRX2681646 KPN1556 11 1 3 1 11 1 2
77 Human Urine negative USA QIWX01000001.1 WUSM_KV_51 11 1 3 1 11 1 2
78 Human Urine SHV-12/SHV-66 USA SRX2681570 KPN1751 1 6 10 3 37 1 4
78 Human Urine negative Belgium UKAP01000001.1 EuSCAPE_BE032 1 6 10 3 37 1 4
79 Human Urine negative India LZGB01000001.1 KV093 15 6 1 1 38 14 4
80 Plant/Fungus Mycorrhiza of Pisolithus tinctorius negative China LQMR01000001.1 KV321 29 4 6 1 1 14 4
81 Human Catheter negative Mexico This work 9635 2 6 12 38 39 16 4
82 Plant Root of a sugarcane plant negative Mexico FLLH01000001 KvMx2 30 25 21 39 40 17 4
83 Human Faeces negative China NLDD01000001 L18 31 24 22 40 41 1 11
84 Environmental Industrial effluent negative Pakistan MSCS01000001 MB351 11 26 2 41 1 1 6
85 Animal Bovine - Mastitis negative Canada LFYK01000000 NL58 1 10 14 42 2 13 6
85 Animal Bovine - Mastitis negative Canada LGAW01000000 NL49 1 10 14 42 2 13 6
86 Animal Bovine - Intestinal negative USA ERS011908 QMP_B2-288 11 27 5 41 1 1 6
86 Human Urine negative Greece UKAQ01000001.1 EuSCAPE_GR014 11 27 5 41 1 1 6
87 Animal Bovine - Intestinal negative USA ERS011920 QMP_B2-340 13 28 3 9 1 1 2
87 Animal Bovine - Intestinal negative USA ERS011926 QMP_B2-483 13 28 3 9 1 1 2
88 Animal Bovine - Intestinal negative USA ERS011925 QMP_B2-481 2 1 3 38 4 18 6
89 Animal Bovine - Intestinal Negative (LEN-type negative) USA ERS011933 QMP_M1-043 1 17 1 25 42 1 4
90 Animal Unknown negative USA ERS011961 QMP_M1-428 32 29 3 24 35 19 4
91 Animal Urine Negative (LEN-type negative) USA ERS011977 QMP_M1-893 33 6 1 11 43 1 4
92 Human missing CTX-M-15/KPC-2 China PWAV01000001.1 SCKV020062 1 6 23 43 1 1 4
92 Human missing CTX-M-15/KPC-2 China PWAU01000001.1 SCKV020067 1 6 23 43 1 1 4
92 Human missing CTX-M-15/KPC-2 China PWAT01000001.1 SCKV020069 1 6 23 43 1 1 4
92 Human Unknown negative China NZ_CP028555.1 WCHKP19 1 6 23 43 1 1 4
93 Human missing NDM-5 China NWEW01000001.1 SCKV020148 1 3 3 2 3 20 3
94 Human missing CTX-M-15 South Africa NXJG01000001.1 ST-1791-KOO1 34 6 6 1 35 1 4
95 Environmental GM-anode biofilm negative missing DBMQ01000001.1 UBA694 18 24 5 1 1 1 4
96 Environmental Metal/Plastic negative USA DFSA01000001.1 UBA3449 11 4 10 6 44 8 2
97 Environmental Metal/Plastic negative USA DGAC01000001.1 UBA4040 13 24 6 30 1 1 2
98 Human Unknown negative China NZ_CP027064.2 WCHKV030666 28 30 5 37 1 1 2
99 Human Unknown negative China NWEJ01000001.1 WCHKV030937 35 4 6 1 1 1 2
100 Human Urine negative USA QIYV01000001.1 WUSM_KV_01 6 24 5 1 1 1 4
101 Human Unknown negative USA QIYV01000001.1 WUSM_KV_02 2 5 6 3 5 1 2
102 Human Aspirate, left breast negative USA QIYT01000001.1 WUSM_KV_03 23 19 2 8 45 1 2
103 Human Sputum negative USA QIYQ01000001.1 WUSM_KV_06 36 6 10 3 37 1 4
103 Human Urine negative USA QIXK01000001.1 WUSM_KV_38 36 6 10 3 37 1 4
103 Human Wound negative USA QIWZ01000001.1 WUSM_KV_49 36 6 10 3 37 1 4
103 Human Blood negative Germany UJZE01000001.1 EuSCAPE_DE052 36 6 10 3 37 1 4
104 Human Urine negative USA QIYP01000001.1 WUSM_KV_07 2 27 6 2 1 13 6
105 Human Drainage, left groin negative USA QIYO01000001.1 WUSM_KV_08 2 6 1 25 32 11 2
105 Human Tibia negative USA QIYL01000001.1 WUSM_KV_11 2 6 1 25 32 11 2
105 Human Urine negative Italy UJZU01000001.1 EuSCAPE_IT360 2 6 1 25 32 11 2
106 Human Urine negative USA QIYK01000001.1 WUSM_KV_12 5 31 5 44 46 13 2
107 Human Urine negative USA QIYJ01000001.1 WUSM_KV_13 37 32 1 3 37 7 4
108 Human Blood negative USA QIYI01000001.1 WUSM_KV_14 38 33 24 45 47 1 6
108 Human Urine negative USA QIYD01000001.1 WUSM_KV_19 38 33 24 45 47 1 6
109 Human Blood negative USA QIYG01000001.1 WUSM_KV_16 39 1 1 1 1 1 1
110 Human Urine negative USA QIYE01000001.1 WUSM_KV_18 11 1 6 46 48 2 4
111 Human Urine negative USA QIYB01000001.1 WUSM_KV_21 40 27 6 3 1 13 6
112 Human Urine negative USA QIYA01000001.1 WUSM_KV_22 41 5 6 8 4 2 2
112 Human Urine negative USA QIXZ01000001.1 WUSM_KV_23 41 5 6 8 4 2 2
112 Human Blood negative USA QIXY01000001.1 WUSM_KV_24 41 5 6 8 4 2 2
113 Human Blood negative USA QIXX01000001.1 WUSM_KV_25 14 1 6 1 36 1 2
113 Human Urine negative USA QIXN01000001.1 WUSM_KV_35 14 1 6 1 36 1 2
114 Human Urine negative USA QIXV01000001.1 WUSM_KV_27 1 28 6 43 49 13 2
115 Human Urine negative USA QIXU01000001.1 WUSM_KV_28 11 23 6 1 35 1 10
116 Human Urine negative USA QIXT01000001.1 WUSM_KV_29 2 4 6 24 4 21 2
116 Human Urine negative USA QIXQ01000001.1 WUSM_KV_32 2 4 6 24 4 21 2
117 Human Urine negative USA QIXR01000001.1 WUSM_KV_31 42 1 3 47 1 7 12
118 Human Urine negative USA QIXL01000001.1 WUSM_KV_37 41 5 6 8 35 2 2
119 Human Urine negative USA QIXJ01000001.1 WUSM_KV_39 1 18 12 1 34 13 2
120 Human Urine negative USA QIXH01000001.1 WUSM_KV_41 35 27 6 3 1 13 6
121 Human Urine negative USA QIXE01000001.1 WUSM_KV_44 38 34 1 1 35 1 10
122 Human Bronchial wash negative USA QIWY01000001.1 WUSM_KV_50 5 8 7 40 11 11 4
123 Human Urine negative USA QIWW01000001.1 WUSM_KV_52 1 3 12 1 1 10 2
124 Human Urine negative USA QIWV01000001.1 WUSM_KV_53 9 4 5 1 32 13 4
125 Human Blood CTX-M-14/KPC-2 USA QIWU01000001.1 WUSM_KV_54 43 1 3 38 4 1 4
125 Human Urine negative Austria UJZA01000001.1 EuSCAPE_AT005 43 1 3 38 4 1 4
126 Human BAL negative USA QIWT01000001.1 WUSM_KV_55 1 19 1 38 1 1 4
127 Human UR CVS negative USA QIVS01000001.1 WUSM_KV_82 1 10 6 45 22 7 6
128 Human Blood negative USA QIVD01000001.1 WUSM_KV_97 1 35 1 48 35 1 2
129 Human Blood negative USA QIUP01000001.1 WUSM_KV_111 13 6 6 41 50 2 4
130 Human missing SHV-40/KPC-2 USA PGIO01000001.1 YD626-2 1 4 5 6 9 1 2
131 Plant Potato negative Japan AP014950.1 YH43 44 22 20 49 51 22 7
132 Human Puncture Fluids negative Belgium UKAT01000001.1 EuSCAPE_BE101 28 30 3 37 1 1 2
133 Human Other (gall bladder) negative Germany UJZJ01000001.1 EuSCAPE_DE018 13 15 1 1 22 1 2
134 Human Wound Secretion negative Germany UJZI01000001.1 EuSCAPE_DE056 2 4 3 38 52 18 4
135 Human Wound Secretion negative Germany UJZK01000001.1 EuSCAPE_DE060 11 1 5 41 53 1 6
137 Human Lower Respiratory Tract Secrection negative Germany UJZL01000001.1 EuSCAPE_DE087 9 24 16 50 1 13 2
138 Human Blood negative Denmark UJZZ01000001.1 EuSCAPE_DK012 45 37 25 8 11 23 13
139 Human Wound Secretion negative Estonia UJZB01000001.1 EuSCAPE_EE016 1 6 18 29 1 7 4
140 Human Puncture Fluids SHV-1 (not ESBL) Spain UJZX01000001.1 EuSCAPE_ES230 11 27 2 51 53 4 2
141 Human Blood negative Francia UJZD01000001.1 EuSCAPE_FR080 1 4 5 1 15 1 14
142 Human Lower Respiratory Tract Secrection negative Croatia UKAG01000001.1 EuSCAPE_HR006 9 17 13 3 7 1 4
143 Human Lower Respiratory Tract Secrection negative Croatia UKAR01000001.1 EuSCAPE_HR033 11 24 18 52 54 3 2
144 Human Blood negative Hungary UJZW01000001.1 EuSCAPE_HU040 1 3 6 8 11 1 2
144 Human Urine negative Portugal UKAH01000001.1 EuSCAPE_PT061 1 3 6 8 11 1 2
145 Human Blood negative Ireland UKAL01000001.1 EuSCAPE_IE014 1 10 6 25 11 13 6
146 Human Blood negative Ireland UKAZ01000001.1 EuSCAPE_IE021 1 4 5 2 9 1 2
146 Human Blood negative United Kingdom UKAE01000001.1 EuSCAPE_UK107 1 4 5 2 9 1 2
147 Human Blood negative Israel UJZN01000001.1 EuSCAPE_IL071 11 28 6 43 55 13 2
148 Human Urine negative Italy UJZV01000001.1 EuSCAPE_IT091 28 3 5 53 1 1 2
149 Human Lower Respiratory Tract Secrection negative Italy UJZP01000001.1 EuSCAPE_IT159 5 38 5 44 46 13 2
150 Human Urine negative Italy UJZR01000001.1 EuSCAPE_IT191 1 17 14 10 39 1 4
151 Human Blood negative Italy UJZO01000001.1 EuSCAPE_IT251 1 18 12 1 56 1 2
152 Human Blood negative Italy UKAC01000001.1 EuSCAPE_IT309 2 39 1 12 1 2 4
153 Human Urine negative Italy UJZT01000001.1 EuSCAPE_IT344 1 18 12 1 1 10 2
154 Human Urine negative Italy UJZS01000001.1 EuSCAPE_IT389 1 3 6 12 3 24 15
155 Human Urine negative Norway UJZH01000001.1 EuSCAPE_NO020 9 40 1 54 57 1 5
156 Human Urine negative Poland UJZC01000001.1 EuSCAPE_PL033 46 28 16 38 58 16 4
157 Human Urine negative Portugal UKAA01000001.1 EuSCAPE_PT077 47 41 1 13 13 1 5
158 Human Puncture Fluids SHV-1 (not ESBL) Romania UKAJ01000001.1 EuSCAPE_RO063 11 5 12 1 59 4 2
159 Human Pus negative Romania UKAK01000001.1 EuSCAPE_RO090 2 4 3 38 4 18 4
160 Human Blood SHV-12, OXA-9 Serbia UKAO01000001.1 EuSCAPE_RS096 1 18 3 1 1 13 2
161 Human Puncture Fluids OXA-1 (not ESBL) Slovenia UKAB01000001.1 EuSCAPE_SI005 31 42 26 20 1 25 4
162 Human Urine negative Slovenia UKAD01000001.1 EuSCAPE_SI024 38 24 6 1 35 1 10
163 Human Urine negative Turkey UKAS01000001.1 EuSCAPE_TR218 13 1 6 1 1 13 4
164 Human Urine CTX-M-3 Turkey UKAU01000001.1 EuSCAPE_TR259 1 6 5 1 32 1 2
165 Human Urine negative United Kingdom UKAF01000001.1 EuSCAPE_UK089 16 1 5 41 34 1 6
166 Human Urine negative United Kingdom UKAI01000001.1 EuSCAPE_UK124 48 4 3 1 60 4 2
167 Animal (migratory bird) unknown unknown Brazil in process M50 1 36 12 1 1 1 2
168 Human Catheter unknown Brazil GCA_012274355.1 Kv57 19 24 1 1 1 1 2
169 Human unknown negative Brazil in process 18L 49 4 6 1 36 1 2
170 Human Urine negative Brazil GCA_012274425.1 Kv15 50 3 5 20 35 4 2
171 Human Blood negative Brazil GCA_012274365.1 Kv35 11 43 6 1 35 1 2
172 Human Urine unknown Brazil GCA_012274385.1 Kv97 18 20 1 55 11 1 4
172 Human Blood unknown Brazil GCA_012274345.1 Kv104 18 20 1 55 11 1 4
173 Human Catheter SHV-12 Chile VSSZ00000000.1 UCO-495 10 9 6 1 11 1 2
174 Animal Liver Negative China CP047360 AHKv-S01 19 6 5 1 5 7 4
175 River Water blaCTX-M-15, blaTEM-1B, blaLEN16 Brazil Under submission (In process) SQ91 51 6 27 56 61 1 4
176 Food Soybean sprout blaCTX-M-14 Switzerland CP067261-CP067264 E25 1 3 12 12 3 1 2
177 Human Missing Negative Missing NZ_LR130544.1 03-311-0071 52 39 5 57 1 13 4
61 Human Missing Negative Missing NZ_LR130543.1 04153260899A 1 9 6 1 13 1 6
178 Environment Missing Negative Switzerland CP048379.1 118 53 22 20 49 62 17 7
132 Human Missing Negative China NZ_CP032354.1 15WZ-82 28 30 3 37 1 1 2
10 Human pure culture KPC-3 France VUCX00000000.1 171J7 1 4 10 6 9 1 2
33 Human Missing Negative Missing CDQZ00000000.1 1f2B 15 6 15 1 22 1 2
142 Human Culture SFO-1/IMP-4/OXA-1 (not ESBL) China RXMC00000000.1 20118 9 17 13 3 7 1 4
179 Human Missing Negative United Kingdom UNYJ00000000.1 2485STDY5438211 11 4 6 58 63 2 2
180 Human Missing Negative United Kingdom UNYV00000000.1 2485STDY5438212 54 20 6 59 5 1 2
181 Human Missing Negative United Kingdom UOBV00000000.1 2485STDY5438376 1 10 1 15 64 14 6
88 Human Missing Negative United Kingdom UODS00000000.1 2485STDY5438395 2 1 3 38 4 18 6
114 Human Missing Negative United Kingdom UOCJ00000000.1 2485STDY5477939 1 28 6 43 49 13 2
181 Human Missing Negative United Kingdom UOCE00000000.1 2485STDY5477945 1 10 1 15 64 14 6
182 Human Missing Negative United Kingdom UODE00000000.1 2485STDY5477978 1 10 1 15 1 14 6
33 Human Missing Negative Missing NZ_CDPS01000072.1 2b2A 15 6 15 1 22 1 2
183 Human Culture IMP-4 China RXMR00000000.1 4095 1 3 12 1 11 1 2
184 Human Missing Negative Thailand UFGF00000000.1 4300STDY6470483 55 24 6 2 65 1 2
185 Human Feces Negative United Kingdom CABGVU000000000.1 4928STDY7071124 23 44 5 1 34 1 2
186 Human Feces Negative United Kingdom CABHBZ000000000.1 4928STDY7387670 56 24 16 60 34 3 4
187 Human Feces Negative United Kingdom CABHDK000000000.1 4928STDY7387724 1 19 12 1 1 10 2
188 Human Feces Negative United Kingdom NZ_LR607362.1 4928STDY7387736 19 5 5 2 10 1 2
185 Human Feces Negative United Kingdom LR607358.1 4928STDY7387758 23 44 5 1 34 1 2
189 Human Feces Negative United Kingdom CABHFR000000000.1 4928STDY7387791 1 4 5 43 66 14 2
185 Human Feces Negative United Kingdom NZ_CABHJP010000001.1 4928STDY7387946 23 44 5 1 34 1 2
188 Human Feces Negative United Kingdom CABHJJ000000000.1 4928STDY7387950 19 5 5 2 10 1 2
190 unknown unknown Negative unknown CAAGTB000000000.1 5012STDY7312721 57 4 6 1 1 1 2
191 unknown unknown Negative unknown CAAGUK000000000.1 5012STDY7312728 57 4 6 25 1 1 2
192 unknown unknown Negative unknown CAAGUP000000000.1 5012STDY7312732 1 27 6 1 67 1 2
193 Human Urine OXA-48 Norway NZ_LNIR01000086.1 50878013 58 45 6 25 35 13 6
194 Human Feces NDM-1 Romania PEHS00000000.1 6TM 1 46 28 1 11 1 2
69 Human Culture OXA-1 (not ESBL)/IMP-4 China RXMP00000000.1 7041 25 21 3 35 35 1 2
195 Animal Milk - cow Negative USA PIDP00000000.1 A8 31 6 5 8 1 1 4
56 Human Urine Negative Australia NZ_LR130539.1 AJ055 21 18 3 2 1 13 2
196 Human Lung Negative USA VKXX00000000.1 AS012291 22 6 1 20 68 26 5
101 Human Lung Negative USA WFGU00000000.1 AS012294 2 5 6 3 5 1 2
197 Human Lung Negative USA VKXJ00000000.1 AS012311 1 6 3 2 3 1 3
198 Human Lung Negative USA VKVS00000000.1 AS012372 24 3 1 32 33 1 4
94 Human Lung Negative USA VKUS00000000.1 AS012406 34 6 6 1 35 1 4
199 Human Lung Negative USA VKTV00000000.1 AS012432 1 3 6 12 11 1 2
200 Human Lung Negative USA VKTF00000000.1 AS012453 12 19 13 1 1 1 4
201 unknown unknown Negative unknown CDRB00000000.1 B8C2 4 20 6 2 10 1 4
60 Human Blood Negative Bangladesh PJQN00000000.1 BD_DM_07 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/ OXA-1(not ESBL) Bangladesh QTZZ00000000.1 BD_DM_405b 11 6 5 30 16 4 4
60 Human Blood OXA-1 (not ESBL)/CTX-M-15 Bangladesh PJQO00000000.1 BD_DM_414 11 6 5 30 16 4 4
202 Human Rectal swab Negative Tanzania JAAFAQ000000000.1 BS68R-1-A 1 47 12 22 52 1 4
42 unknown Cell culture Negative unknown LBCM00000000.1 CICC10011 18 6 4 1 1 6 2
203 Human Missing SHV-12 Colombia NCMP00000000.1 COL-Kpn36 59 32 29 61 69 27 4
14 Human Missing NDM-5 USA JABKRN000000000.1 CRE 135 7 3 6 8 12 4 3
204 Human Missing OXA-1(not ESBL)/CTX-M-15 USA JABKRM000000000.1 CRE 165 60 39 6 33 39 13 4
204 Human Missing OXA-1(not ESBL)/CTX-M-16 USA JABKRL000000000.1 CRE 180 60 39 6 33 39 13 4
205 Human Missing KPC-31 USA JABKRK000000000.1 CRE 184 1 20 1 1 70 16 6
53 Human Miscellaneous body fluid KPC-2 USA PTGT00000000.2 CRK0383 1 21 1 25 30 11 4
206 Animal rumen fluid (camel) Negative India JABRVG000000000.1 CRN 15 61 24 5 3 61 1 5
207 Animal rumen fluid (camel) Negative India JABRVJ000000000.1 CRN 19 14 24 6 44 13 3 2
136 Human Blood KPC-2 Germany UJZM01000001.1 EuSCAPE_DE073 11 36 6 1 1 6 2
208 unknown Missing Negative unknown VHID00000000.1 F10CI 1 10 1 10 1 1 2
209 Human Clinical isolate Negative USA JAAXYY000000000.1 FDAARGOS_625 2 48 6 50 1 6 2
210 Human Clinical isolate Negative USA NZ_CP044049.1 FDAARGOS_627 22 6 5 13 44 1 4
211 Human Missing Negative USA CP050958.1 FDAARGOS_628 1 3 12 12 71 1 2
212 Environment Soil Negative China CP054254.1 FH-1 1 19 30 12 72 1 4
213 Plant Plantain Negative Haiti WNLK00000000.1 G18-1365 11 4 10 1 34 1 10
213 Plant Plantain Negative Haiti WNLL00000000.1 G18-1376 11 4 10 1 34 1 10
214 Plant Cenchrus macrourus Negative China CP031061.1 GN02 11 28 5 12 9 2 2
215 Animal Forrest musk deer Negative China NZ_LNIR00000000.1 GPKP 62 10 1 29 1 1 4
216 Environment Activated sludge Negative China VJZH00000000.1 Glu3 10 49 12 44 11 4 2
217 Human Missing Negative China JACNNG000000000.1 K022 28 6 5 37 1 1 2
68 Human Missing Negative China JACNOL000000000.1 K088 1 18 6 1 34 13 2
218 Human Blood OXA-9/SHV-12 United Kingdom NZ_FLJK00000000.1 K1670 19 5 6 1 1 1 2
219 Plant Alfalfa sprouts Negative Germany VTUK00000000.1 K2 1 3 6 12 11 13 2
220 Human Blood OXA-48 United Kingdom NZ_FLDD00000000.1 K379 1 27 2 24 73 1 4
221 Human Blood CTX-M-9 Brazil RCHX00000000.1 K5-12018 44 50 31 62 74 17 16
222 Human Missing CTX-M-15 China JACNQQ000000000.1 K7043 1 1 1 1 11 1 1
16 Human Missing Negative China JACNRD000000000.1 K7063 9 3 12 8 3 5 2
132 Human Missing CTXM-14/LAP-2 China JACNRV000000000.1 K7089 28 30 3 37 1 1 2
223 Human Missing OXA-1 (not ESBL)/LAP-2 China JACNTB000000000.1 K7132 1 51 5 2 75 1 6
224 Human Missing CTX-M-99/DHA-1/CTXM-122/CTXM-65/CTXM-196/CTX-M-125/CTX-M-14/ China JACNVK000000000.1 K824 63 52 6 32 1 1 2
225 Human Not collected CTX-M-15 China JACJGZ000000000.1 K915 11 27 2 8 45 28 2
115 Human Missing Negative China CP060807.1 KP2757 11 23 6 1 35 1 10
226 Human Clinical material TEM-135/TEM-106/TEM-126 South Africa CACRXS000000000.1 Kpn01734 1 53 5 32 9 1 4
227 unknown unknown VIM-1 unknown CACSDT000000000.1 Kpngiani7132485 11 44 6 51 34 13 2
228 Human Urinary tract infection LEN-16 USA JACJGZ000000000.1 LEMB11 1 9 1 8 11 1 2
137 Animal Choanal swab (Dendrocygna viduata) Negative Brazil JAAGEJ000000000.1 M14 9 24 16 50 1 13 2
137 Animal Choanal swab (Dendrocygna viduata) Negative Brazil JAAGEK000000000.1 M15 9 24 16 50 1 13 2
229 Animal Pork from retail store Negative China JAALEX000000000.1 M-20-X3 58 1 12 8 1 1 2
229 Animal Pork from retail store Negative China JAALFA000000000.1 M-20 58 1 12 8 1 1 2
54 Human Feces Negative unknown CAAKOL000000000.1 MC1 1 5 5 1 1 1 2
230 Plant Salacia chinensis Negative India CAJCKQ000000000.1 ME73 16 1 5 1 76 1 6
230 Plant Madhuca insignis Negative India CAJCKL000000000.1 ME79 16 1 5 1 76 1 6
123 Human Bile (fluid) Negative USA NZ_KK737658.1 MGH76 1 3 12 1 1 10 2
231 Human Gut Negative Australia CABMNH000000000.1 MGYG-HGUT-02511 11 5 14 25 1 13 6
199 Human Stool Negative USA QYMI00000000.1 N015.H-29 1 3 6 12 11 1 2
10 Human Stool Negative USA RHFL00000000.1 N041.A-12 1 4 10 6 9 1 2
232 unknown Missing Negative unknown UGND00000000.1 NCTC10262 64 10 2 25 1 13 2
233 unknown Missing Negative unknown UGLX00000000.1 NCTC11695 65 12 5 15 15 1 4
234 unknown Urine Negative unknown NZ_CABDWI010000002.1 NCTC9169 66 1 12 1 77 1 2
120 unknown Missing Negative unknown NZ_LR134235.1 NCTC9668 35 27 6 3 1 13 6
235 Animal gut- Mus musculus Negative Canada SSTO00000000.1 NM43_TS4-1 11 54 5 1 11 1 6
236 unknown Grower Feed Negative USA VFLS00000000.1 PF-1 67 3 6 8 11 1 2
236 unknown Grower Feed Negative USA VFLW00000000.1 PF-5 67 3 6 8 11 1 2
237 Environment Freshwater biome Negative United Kingdom CP056145.1 RHBSTW-00883 11 12 5 15 15 1 2
218 unknown Missing Negative unknown CAAHFX000000000.1 SB1 19 5 6 1 1 1 2
89 unknown Missing Negative unknown USZY00000000.1 SB3295 1 17 1 25 42 1 4
68 unknown Missing Negative unknown USZZ00000000.1 SB3301 1 18 6 1 34 13 2
238 unknown Missing Negative unknown UTAB00000000.1 SB497 1 6 6 63 32 1 2
239 unknown Missing Negative unknown CAAHGL000000000.1 SB5387 53 55 20 64 78 17 7
240 unknown Missing Negative unknown CAAHGM000000000.1 SB5439 30 25 32 65 79 29 4
241 unknown Missing Negative unknown CAAHGN000000000.1 SB5531 30 25 32 39 80 17 4
242 unknown Missing Negative unknown CAAHGO000000000.1 SB5544 30 56 21 66 81 17 4
243 unknown Missing Negative unknown CAAHGP000000000.1 SB5610 68 57 33 67 82 17 7
146 Human Missing CTX-M-15 South Africa Durban NZ_LJEQ00000000.1 ST1478:939997103 1 4 5 2 9 1 2
32 Human Rectal swab OXA-1 (not ESBL)/KPC-2/CTX-M-15 Brazil SZND00000000.1 ST681 14 16 14 15 21 7 2
244 Human Missing Negative Japan BIGL00000000.1 TUM14006 16 1 2 41 53 13 6
244 Human Missing Negative Japan BIGM00000000.1 TUM14007 16 1 2 41 53 13 6
16 Human Missing Negative Japan BIGP00000000.1 TUM14010 9 3 12 8 3 5 2
98 Human Missing Negative Japan BIGQ00000000.1 TUM14011 28 30 5 37 1 1 2
98 Human Missing Negative Japan BIGR00000000.1 TUM14012 28 30 5 37 1 1 2
245 Human Missing Negative Japan BIHA00000000.1 TUM14021 11 27 12 68 1 7 2
246 Human Missing Negative Japan BIHE00000000.1 TUM14025 1 3 6 8 11 1 17
247 Human Missing Negative Japan BIHH00000000.1 TUM14028 69 1 1 1 11 1 1
248 Human Missing Negative Japan BIHM00000000.1 TUM14033 19 24 5 6 5 7 2
249 Human Missing Negative Japan BIHO00000000.1 TUM14035 1 58 1 2 83 13 6
113 Human Missing Negative Japan BIHQ00000000.1 TUM14037 14 1 6 1 36 1 2
250 Human Missing Negative Japan BIIL00000000.1 TUM14058 1 59 1 69 37 11 10
251 Human Missing Negative Japan BIJE00000000.1 TUM14077 70 5 6 3 5 1 2
252 Human Missing Negative Japan BIJF00000000.1 TUM14078 2 39 6 9 55 1 18
253 Human Missing Negative Japan BIJG00000000.1 TUM14079 71 4 34 70 1 1 5
222 Human Missing Negative Japan BIJM00000000.1 TUM14085 1 1 1 1 11 1 1
254 Human Missing Negative Japan BIJN00000000.1 TUM14086 72 27 3 55 84 1 4
1 Human Missing Negative Japan BIJW00000000.1 TUM14095 1 1 1 1 1 1 1
61 Human Missing Negative Japan BIJX00000000.1 TUM14096 1 9 6 1 13 1 6
92 Human Missing Negative Japan BIKC00000000.1 TUM14103 1 6 23 43 1 1 4
255 Human Missing Negative Japan BIKI00000000.1 TUM14109 57 60 13 1 1 1 2
256 Human Missing Negative Japan BIKO00000000.1 TUM14115 1 19 12 68 3 1 2
257 Human Missing Negative Japan BILJ00000000.1 TUM14136 11 61 5 44 35 3 4
61 Animal Bos indicus - urine Negative Brazil JAAVMD000000000.1 UFMG-H10 1 9 6 1 13 1 6
61 Animal Bos indicus - urine Negative Brazil JAAVME000000000.1 UFMG-H9 1 9 6 1 13 1 6
181 Environment Sewage Negative United Kingdom NZ_FWHD00000000.1 VRCO0019 1 10 1 15 64 14 6
258 Human Sewage Negative United Kingdom NZ_FWGT00000000.1 VRCO0021 9 62 6 35 85 30 19
199 Environment Sewage Negative United Kingdom NZ_FWWJ00000000.1 VRCO0037 1 3 6 12 11 1 2
259 Environment Sewage Negative United Kingdom NZ_FWGF00000000.1 VRCO0145 1 24 3 44 13 3 2
19 Environment Sewage Negative United Kingdom NZ_FWOH00000000.1 VRCO0179 1 4 1 1 11 1 2
260 Human Feces Negative United Kingdom NZ_FWOP00000000.1 VRCO0242 1 10 14 42 86 13 6
260 Human Feces Negative United Kingdom NZ_FWOX00000000.1 VRCO0243 1 10 14 42 86 13 6
260 Human Feces Negative United Kingdom NZ_FWLD00000000.1 VRCO0244 1 10 14 42 86 13 6
260 Human Feces Negative United Kingdom NZ_FWLG00000000.1 VRCO0246 1 10 14 42 86 13 6
261 Human Feces Negative United Kingdom NZ_FWPE00000000.1 VRCO0296 11 1 3 71 87 1 4
261 Human Feces Negative United Kingdom NZ_FWPH00000000.1 VRCO0298 11 1 3 71 87 1 4
261 Human Feces Negative United Kingdom NZ_FWMH00000000.1 VRCO0299 11 1 3 71 87 1 4
261 Human Feces Negative United Kingdom NZ_FWPI00000000.1 VRCO0300 11 1 3 71 87 1 4
10 Human Feces Negative United Kingdom NZ_FWMT00000000.1 VRCO0375 1 4 10 6 9 1 2
10 Human Feces Negative United Kingdom NZ_FWMV00000000.1 VRCO0376 1 4 10 6 9 1 2
68 Human Blood Negative United Kingdom NZ_FWOA00000000.1 VRCO0486 1 18 6 1 34 13 2
262 Human Urine Negative USA QIYR00000000.1 WUSM_KV_05 1 28 2 29 9 2 4
263 Human Urine Negative USA QIXO00000000.1 WUSM_KV_34 6 39 16 61 11 1 6
264 Human Urine Negative USA QIXG00000000.1 WUSM_KV_42 73 4 6 24 4 21 2
20 Human Urine Negative USA QIXB00000000.1 WUSM_KV_47 1 10 2 10 14 1 2
265 Animal mice gut CTX-M-15 China JAAGKT000000000.1 Z5 16 1 5 41 88 1 6
266 Human Missing Negative China CABWVW000000000.1 ZKP147 18 4 5 1 89 1 2
267 Human Missing Negative China CABWWV000000000.1 ZKP176 1 3 12 1 1 1 2
101 Human Missing Negative China CABWXA000000000.1 ZKP186 2 5 6 3 5 1 2
268 Human Missing Negative China CABWWN000000000.1 ZKP4 1 63 7 2 90 1 2
269 Human Missing Negative China CABWWO000000000.1 ZKP7 1 19 6 20 52 1 2
187 Human Missing Negative China CABWUC000000000.1 ZKP74 1 19 12 1 1 10 2
270 Human Blood SHV-12/OXA-9/TEM-29/TEM-122/TEM-141/TEM-55/TEM-135/TEM-57 United Kingdom NZ_FLHG00000000.1 k1148 42 3 3 29 1 7 12
108 Human Blood SHV-12/CTX-M-9 United Kingdom NZ_FLBS00000000.1 k1154 38 33 24 45 47 1 6
271 Human Blood Negative United Kingdom NZ_FLBY00000000.1 k1309 1 4 3 1 11 1 2
270 Human Blood Negative United Kingdom NZ_FLBV00000000.1 k1527 42 3 3 29 1 7 12
272 Animal Milk from dairy animals with mastitis (culture) Negative Canada NZ_FLEC00000000.1 k305 1 4 35 20 1 1 20
273 Human Blood Negative United Kingdom NZ_FLDE00000000.1 k336 11 64 2 8 3 1 2
274 Human Blood TEM-141/TEM-57/TEM-55/TEM-135/SHV-12/OXA-9/TEM-122/TEM-29 United Kingdom NZ_FLDI00000000.1 k385 23 44 36 1 34 1 2
275 Human Blood Negative United Kingdom NZ_FLEA00000000.1 k841 9 4 3 72 91 1 6
20 Human Blood OXA-9/SHV-12 United Kingdom NZ_FLER00000000.1 k911 1 10 2 10 14 1 2
271 Human Blood OXA-9/ SHV-12 United Kingdom NZ_FLES00000000.1 k913 1 4 3 1 11 1 2
10 Human Blood SHV-12/ OXA-9 United Kingdom NZ_FLIQ00000000.1 k916 1 4 10 6 9 1 2
276 Human Blood SHV-12 United Kingdom NZ_FLET00000000.1 k967 74 28 5 2 15 7 2
20 unknown Missing CTX-M-15/OXA-1 (not ESBL) unknown CABEGD000000000.1 k_variicola_1 1 10 2 10 14 1 2
20 unknown Missing CTX-M-15 unknown CABEGE000000000.1 k_variicola_2 1 10 2 10 14 1 2
20 unknown Missing CTX-M-15 unknown CABEGJ000000000.1 k_variicola_3 1 10 2 10 14 1 2
20 unknown Missing CTX-M-15 unknown CABEGF000000000.1 k_variicola_4 1 10 2 10 14 1 2
20 unknown Missing CTX-M-15 unknown CABEGG000000000.1 k_variicola_5 1 10 2 10 14 1 2
20 unknown Missing CTX-M-15 unknown CABEGI000000000.1 k_variicola_6 1 10 2 10 14 1 2
8 Human Missing Negative China CABWWV000000000.1 ZKP103 1 6 8 5 7 1 5
277 Human Missing NDM-1 Switzerland UWVP00000000.1 kpneu010 31 27 2 33 58 1 2
3 Plant Maize shoots Negative unknown CXOY00000000.1 3 1 3 3 2 3 1 3
278 Human Community-acquired infection LEN-9 Brazil in process 58243 1 21 1 25 1 11 21
279 Human Urine Unknown Sweden PRJNA606666 KLP13 16 1 5 41 92 1 6
261 Human Urine Unknown Sweden PRJNA606666 KLP1420 11 1 3 71 87 1 4
280 Human Urine Unknown Sweden PRJNA606666 KLP189 1 10 5 10 2 1 2
281 Human Urine Unknown Sweden PRJNA606666 KLP1935 16 1 5 41 1 1 6
282 Human Urine Unknown Sweden PRJNA606666 KLP1958 19 65 6 45 1 7 4
283 Human Blood Unknown Sweden PRJNA606666 KLP307 56 24 3 44 93 1 2
284 Human Urine Unknown Sweden PRJNA606666 KLP41 13 15 16 1 22 1 2
285 Human Urine Unknown Sweden PRJNA606666 KLP488 75 27 6 1 35 1 2
286 Human Blood Unknown Sweden PRJNA606666 KLP798 15 6 1 1 35 14 4
196 Human Urine Unknown Sweden PRJNA606666 KLP923 22 6 1 20 68 26 5
196 Human Blood Unknown Sweden PRJNA606666 KLP933 22 6 1 20 68 26 5
279 Human Blood Unknown Sweden PRJNA606666 KLP9 16 1 5 41 92 1 6
287 Human Urine Unknown Sweden PRJNA606666 KLV1115 56 24 3 3 93 1 4
288 Human Urine Unknown Sweden PRJNA606666 KLV1451 76 10 6 1 94 16 4
289 Human Unknown LEN-7, IMP-1 Japan in process FUJ80102 14 6 16 73 34 1 4
290 Human Unknown LEN-16 Japan in process MS6016 14 9 37 1 11 1 2
291 Human Sputum LEN-16 Japan in process NUBL-21983 2 66 6 1 9 13 2
292 Human Urine LEN-13 Japan in process NUBL-22002 11 28 6 43 15 24 2
293 Human Blood LEN-13 Japan in process NUKP-104 10 9 6 1 95 1 6
294 Human Blood LEN-16, LEN-19, LEN-20 Japan in process NUKP-18 1 4 38 2 9 1 2
295 Human Blood LEN-16 Japan in process NUKP-37 28 5 1 1 1 1 2
296 Human Blood LEN-9 Japan in process NUKP-38 19 4 6 1 96 1 22
297 Human Blood LEN-7 Japan in process NUKP-40 50 4 5 20 1 13 2
298 Human Blood LEN-7 Japan in process NUKP-41 1 3 6 12 35 5 2
299 Human Blood LEN-24 Japan in process NUKP-42 2 1 3 1 1 14 2
300 Human Blood LEN-16 Japan in process NUKP-49 1 5 1 1 5 1 2
301 Human Blood LEN-7 Japan in process NUKP-61 1 3 6 12 1 1 2
302 Human Blood LEN-16 Japan in process NUKP-62 18 4 5 69 90 31 4
303 Human Blood LEN-19, LEN-20 Japan in process NUKP-64 11 67 5 1 15 7 2
304 Human Blood LEN-17 Japan in process NUKP-66 11 44 5 51 34 4 2
305 Human Blood LEN-13 Japan in process NUKP-67 10 24 6 1 13 13 4
306 Human Blood LEN-17 Japan in process NUKP-68 14 24 5 1 97 1 2
307 Human Blood LEN-16, LEN-19 Japan in process NUKP-82 13 68 6 1 35 1 2
308 Human Blood LEN-17 Japan in process NUKP-84 6 4 3 1 98 14 2
309 Human Blood LEN-8 Japan in process NUKP-86 1 6 39 2 3 1 3
310 Human Blood LEN-22 Japan in process NUKP-24 1 6 8 5 7 32 5
311 Human Blood LEN-13 Japan in process NUKP-33 1 36 6 50 3 1 2
312 Human Blood LEN-13 Japan in process NUKP-55 1 4 3 50 87 1 6
313 Human Blood LEN-16 Japan in process NUKP-88 1 6 6 50 70 1 2
114 Human Blood LEN-17 Japan in process NUKP-32 1 28 6 43 49 13 2
314 unknown unknown Unknown Nigeria in process OB16_B 11 5 10 74 13 1 4
315 Turtle (Gopherus berlandieri) Feces Negative Mexico in process 2268 11 10 6 1 1 1 2
316 Fruit Bats (Pteropus poliocephalus) FecalSwab Unknown Australia in process FF907 1 10 30 12 99 1 2
317 Human FecalSwab Unknown Mexico in process 80 19 69 6 20 1 1 4

Who is Klebsiella variicola?

K. variicola is a Gram-negative, facultative anaerobic, non-spore-forming, non-motile rod. Its form is circular, convex and smooth colonies and grows around 11-41ºC. K. variicola was initially identified as endophyte in plants and pathogen in humans. However, according to different reports it could be considered ubiquitous in nature. According to its description in the literature, K. variicola can be found in soil, water, plants, insects, humans and animals. In all of them K. variicola plays different roles as; endophyte in plants, as pathogen in humans and animals and symbiont in insects.

Recent publication about K. variicola:

Exploring the environmental traits and applications of Klebsiella variicola
Duran-Bedolla J, Garza-Ramos U, Rodríguez-Medina N, Aguilar Vera A, Barrios-Camacho H.
Braz J Microbiol. 2021 Dec;52(4):2233-2245. doi: 10.1007/s42770-021-00630-z. Epub 2021 Oct 9. Download

Klebsiella variicola Reference Strain F2R9 (ATCC BAA-830) Genome Sequence.
Garza-Ramos U, Rodriguez-Medina N, Lozano-Aguirre L, Silva-Sanchez J, Sanchez-Arias M, Rodriguez-Olguin J, Martínez-Romero E.
Microbiol Resour Announc. 2021 Jul;10(26):e0032921. doi: 10.1128/MRA.00329-21. Epub 2021 Jul 1. Download

A Klebsiella variicola Plasmid Confers Hypermucoviscosity-Like Phenotype and Alters Capsule Production and Virulence.
Rodríguez-Medina N, Martínez-Romero E, De la Cruz MA, Ares MA, Valdovinos-Torres H, Silva-Sánchez J, Lozano-Aguirre L, Martínez-Barnetche J, Andrade V, Garza-Ramos U.
Front Microbiol. 2020 Dec 16;11:579612. doi: 10.3389/fmicb.2020.579612. eCollection 2020. Download

Klebsiella variicola: an emerging pathogen in humans.
Rodríguez-Medina Nadia, Barrios-Camacho Humberto, Duran-Bedolla Josefina, Garza-Ramos Ulises.
Emerging Microbes and Infection. 2019;8(1):973-988. doi: 10.1080/22221751.2019.1634981. Download

Phenotypic and molecular characterization of Klebsiella spp. isolates causing community-acquired infections.
Garza-Ramos U, Barrios-Camacho H, Moreno-Domínguez S, Toribio-Jiménez J, Jardón-Pineda D, Cuevas-Peña J, Sánchez-Pérez A, Duran-Bedolla J, Olguín-Rodriguez J, Román-Román A.
New Microbes New Infect. 2018 Feb 17;23:17-27. Download

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :29-40. Download

Klebsiella variicola and Klebsiella quasipneumoniae genomic analysis provides insights into their capacity to adapt to clinical and plant settings.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jeiry Toribio-Jimenez, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :56-62. Download

Hypervirulence and hypermucoviscosity: Two different but complementary Klebsiella spp. phenotypes?
Catalán-Nájera JC, Garza-Ramos U, Barrios-Camacho H.
Virulence. 2017. Oct 3;8(7):1111-1123. Download

Identification and Characterization of Imipenem-Resistant Klebsiella pneumoniae and Susceptible Klebsiella variicola Isolates Obtained from the Same Patient.
Garza-Ramos U*, Moreno-Dominguez S, Hernández-Castro R, Silva-Sanchez J, Barrios H, Reyna-Flores F, Sanchez-Perez A, Carrillo-Casas EM, Sanchez-León MC, Moncada-Barron D..
Microb Drug Resist. 2016 Apr;22(3):179-84. Download

Draft genome sequences of the Klebsiella variicola plant isolates.
Martinez-Romero Esperanza, Jesús Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesús Martínez-Barnetche, Juan Téllez-Sosa, Rosa Elena Gómez-Barreto, Ulises Garza-Ramos.
Genome Announc. 2015 Sep 10;3(5). Download

Draft genome sequence of the first hypermucoviscous Klebsiella variicola clinical isolate.
Ulises Garza-Ramos; Jesus Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesus Martínez-Barnetche, Veronica Andrade.
Genome Announc. 2015 Apr 9;3(2). Download

Development of a multiplex-PCR probe system for proper identification of Klebsiella variicola.
Ulises Garza-Ramos, Jesús Silva-Sánchez, Esperanza Martínez-Romero, Perla Tinoco, Marisol Pina-Gonzales, Humberto Barrios, Jesús Martínez-Barnetche, Rosa elena Gomez-Barreto, Juan Tellez.
BMC Microbiol. 2015 Dec;15(1):396. Download

SUBMISSIONS

In order to function as such a resource and to maintain the quality of the data, the databases are hand curated, and all entries will be checked before final entry into the main database.

To submit your data please contact the curators directly.

Dr. Ulises Garza Ramos
email: ulises.garza@insp.mx

Dr. Humberto Barrios Camacho
email: humberto.barrios@insp.mx
INSTITUTO NACIONAL DE SALUD PÚBLICA, MÉXICO - DERECHOS RESERVADOS © 2019-2022
Av. Universidad No. 655 Colonia Santa María Ahuacatitlán, Cerrada Los Pinos y Caminera C.P. 62100, Cuernavaca, Morelos. México. Tel. (777) 329 3000
Contact: webmaster_kv@insp.mx
View My Stats