Allelic profile:

leuS pgi pgk phoE pyrG rpoB fusA


Which ST profile has your sequence?, Select your fasta file:


Run average nucleotide identity (ANI)


Enter Query Sequence:




Database developed by the Centro de Investigación Sobre Enfermedades Infecciosas (CISEI) in collaboration with the Centro de Ciencias Genómicas (CCG-UNAM). This site has been funded by the Instituto Nacional de Salud Pública (INSP).

Reference for citations of MLST of K. variicola:
Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises. Molecular epidemiology of Klebsiella variicola obtained from different sources. Scientific Reports. 2019. 9:10610. Download

Reference for citations of MLST of K. variicola:

Molecular epidemiology of Klebsiella variicola obtained from different sources.
Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises.
Scientific Reports. 2019.
Download

Protocol used for MLST of Klebsiella variicola.

Genes of MLST:
leuS(Leucyl-tRNA synthethase)
pgi(Phosphoglucose iomerase)
pgk(Phosphoglycerate kinase)
phoE(Phosphoporine E)
pyrG(CTP synthase)
rpoB(β-subunit of RNA polymerase B)
fusA(Elongation factor G)

PCR Amplification:
444
Gene/primerSequence (5’-3’)Annealing (Tm)Size (bp)Amplification Product (bp)
leuSKv-FCGAACAGGTTATCGACGGCT63 °C594968
leuSKv-RCAAAGGTGTCGGTTTCACGC
pgiKv-FAAAGAGACCGATCTGGCAGG60 °C600760
pgiKv-RACCAGATACCGATCAGCGCC
pgkKv-FTCGTGATGGATGCTTTCGGT63 °C594663
pgkKv-RAGATTTTGTCAGCGATGCCG
phoEKv-FCTGTACGACGTGGAAGCCTG63 °C453613
phoEKv-RCCACGAAGGCGTTCATGTTT
pyrGKv-FCCGATCGCTATGGTCGCTG60 °C522664
pyrGKv-RCGGGACATCAGTTCCGGGT
rpoBKv-FGCCAGCTGTCCCAGTTTATG60 °C513648
rpoBKv-RGAACGGTACCGCCACGTTTA
fusAKv-FCGAAAACCAAAGCTGACCAGG62 °C561782
fusAKv-RCATGGTGTATGATGCACGACCT

Conditions of amplification:

PCR: 3 min at 96°C; 30 cycles of 1 min at 95°C; 30 seg annealing temperature (60°C to 63°C according of amplification gene); 1 min at 72°C. Following 7 min at 72°C.

PCR reaction:
Each reaction contains 10ng of chromosomal DNA, 12.5 pmol of each primer, 25mM of the dNPTs, 1X of PCR Buffer, 1 unit of Taq polymerase and water to 50 ml.

Sequencing of PCR products:
The primer used by PCR amplification were used by Sanger sequencing step

Allele template. Allelic profile of K. variicola 801 (GenBank: CDMV01000001):
leuS (594 bp)
GATCACTGGCCAGACACCGTAAAGACCATGCAGCGCAACTGGATCGGCCGTTCCGAAGGG
GTGGAAATCTCCTTTGACGTCAACAACTACGCCGATAAGCTGACCGTCTACACCACCCGT
CCGGACACCTTTATGGGCTGCACCTACCTGGCTGTCGCGGCGGGTCACCCGCTGGCGCAG
CAGGCTGCAGCGAACAATCCGGCGCTGGCTGCCTTTATCGACGAATGCCGTAATACCAAA
GTAGCCGAAGCCGACATGGCGACGATGGAGAAAAAAGGCGTCGATACCGGGTTTAAAGCC
ATTCACCCGCTGACCGGCGAAGAAATTCCTGTCTGGGCGGCAAACTTCGTGCTGATGGAA
TATGGCACCGGCGCGGTCATGGCCGTTCCGGGTCACGACCAGCGTGACTATGAGTTCGCC
AGCAAGTACGGTCTGAACATCAAGCCGGTTATCCTCGCCGCTGACGGCAGCGAGCCGGAT
CTCTCCGCGCAGGCGCTGACCGAGAAAGGCGTCCTGTTTAACTCCGGCGAGTTCAGCGGC
CTCGATTATGAAGCCGGCTTCAACGCCATTGCCGACAAACTGGCAGCCATGGGC

pgi (600 bp)
GACCGTGCGGTACTGCACGTCGCGCTGCGCAACCGCAGCAATACGCCGATTGTGGTTGAT
GGCAAAGATGTGATGCCGGAAGTGAACGCTGTGCTGGAGAAGATGAAAACCTTCTCAGAA
GCGATTATCTCCGGTAGCTGGAAAGGCTATACCGGCAAACCGATCACCGACGTGGTTAAC
ATTGGTATCGGCGGTTCCGACCTCGGTCCGTTCATGGTCACCGAAGCGCTGCGTCCGTAC
AAAAACCACCTCAACATGCACTTTGTCTCCAACGTCGATGGCACCCACATCGCTGAAGTG
CTGAAGAACGTCAACCCGGAAACGACCCTGTTCCTGGTGGCGTCCAAGACCTTCACCACT
CAGGAAACCATGACCAACGCCCACAGCGCGCGCGACTGGTTCCTGGCGACCGCGGGCGAC
GACAAACACGTGGCCAAACACTTCGCGGCGCTTTCTACCAACGCGAAAGCGGTTGGCGAG
TTCGGCATCGACACCGCCAACATGTTTGAATTCTGGGACTGGGTTGGCGGCCGTTACTCC
CTGTGGTCGGCGATTGGCCTGTCCATCATTCTCTCCGTGGGCTTCGACAACTTCGTTGAG

pgk (444 bp)
GCGTGCGCAGGCCCGCTGCTGGCCGCTGAACTGGACGCGCTGGGTAAAGCGCTGAAAGAG
CCGGCTCGTCCGATGGTCGCTATCGTGGGTGGTTCTAAAGTGTCCACCAAACTGACCGTG
CTGGATTCCCTGTCTAAAATCGCTGACCAGCTGATCGTCGGCGGCGGTATCGCCAACACC
TTCGTTGCTGCCCAGGGCCACAACGTCGGTAAATCCCTGTACGAAGCAGACCTGGTTGAT
GAAGCTAAGCGCCTGCTGAGCACCTGTGATATCCCGGTTCCGACGGACGTTCGCGTCGCG
ACCGAGTTCTCCGAAACCGCAACGGCAACCCTGAAATCTGTTAACGACATCAAAGATGAC
GAGCAGATTCTGGACCTTGGCGACGTTTCCGCACAGAAACTGGCCGACATCCTGAAAAAC
GCCAAAACCATCCTGTGGAACGGC

phoE (453 bp)
GATTCCTCTGCCCAGACCGATAACTTTATGACCAAACGCGCCAGCGGCCTGGCGACCTAC
CGCAATACCGATTTCTTCGGTCTGGTGGATGGTCTGGATATGACCCTGCAGTACCAGGGT
AAAAACGAAGGCCGTGAAGCGAAGAAACAGAACGGCGACGGCGTTGGCACCTCATTAAGC
TATGATTTCGGCGGCAGCGACTTCGCCGTCAGCGCGGCCTACACCAGCTCCGACCGTACC
AACGATCAGAACCTGCTGGCCCGCGGCCAGGGTTCGAAAGCGGAAGCCTGGGCGACCGGC
CTGAAATATGACGCCAACAATATCTACCTGGCGACCATGTATTCTGAGACCCGCAAAATG
ACCCCGATCAGCGGCGGTTTTGCCAACAAAGCGCAGAACTTTGAAGCGGTGGCGCAGTAT
CAGTTCGACTTCGGTCTGCGTCCGTCCCTCGGC

pyrG (522 bp)
ACGTCCTTGCGCATCGCACTGATTGGCCGTGAGTCAGACCACCGTCTGGTCTACCCCGCC
ACGCTTGGCTCACTGGGTGATGCCGCGGCGTCGCTGGGGCTGAACCTGGAGGTCCATTTC
TTCGCGCCGGTCAGTCTGTCCCCTGGGTTACACGACCTCCACGACGTCCAGGGCGTCGTG
TTGCCAGGCGGTTCCTCGATGGCCGCCGTCAAGGGACAAATCCGCGTGGCGGAAGATACG
CTTGCCCGCGGACAGCCCACGCTGGGGTTATGCCTGGGAATGCAGAGCATGATGACCGCA
GTCGTGCGCCGACGTCCGGGTTGCGAATCAGCCATTCCCGCCGAAGTGGCTCCGGATGAG
GCTCTGCACAGCTTTGTTCCCTTTGTTGATGGCCGTCATCGCTGCGGCGTATTCCCTTTT
TCCTTCGGGTTGATCCCCGGTGATATCCGCGAAATGCACTACAACCATCGCTACTGCTTT
AACACCGACTTATTACCGGCGCTGGATCGCAGCGGGGTCAGC

rpoB (513 bp)
ATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGCGCAGGCTTCGAAGTTCGAGAC
GTACACCCGACGCACTACGGTCGCGTATGTCCAATCGAAACGCCTGAAGGTCCGAACATC
GGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATACGGTTTCCTTGAGACC
CCGTATCGTAAAGTGACCGACGGTGTGGTTACCGATGAAATTCACTACCTGTCTGCTATC
GAAGAAGGCAACTACGTTATTGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCACTTC
GTAGAAGACCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAG
GTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCG
TTCCTGGAGCACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCG
GTTCCGACTCTGCGCGCTGATAAGCCGCTGGTT

fusA (561 bp)
AACCAGACCATCATCGCCGGTATGGGTGAGCTGCACCTCGACATCATCGTTGACCGTATG
AAGCGTGAATTCAACGTTGAAGCGAACGTCGGTAAACCTCAGGTTGCTTACCGTGAAGCG
ATTCGCGCGAAAGTTACCGATATCGAAGGTAAACACGCCAAGCAGTCTGGTGGTCGTGGT
CAGTACGGTCACGTTGTGATCGACATGTACCCGCTGGAGCCGGGCTCTAACCCGAAAGGT
TACGAGTTCATCAACGACATCAAAGGTGGTGTAATTCCTGGCGAATACATCCCGGCCGTT
GATAAAGGCATCCAGGAACAGCTGAAAGCTGGTCCGCTGGCAGGTTACCCGGTAGTTGAT
ATGGGTATCCGTCTGCACTTCGGTTCTTACCACGACGTTGACTCCTCTGAGCTGGCGTTT
AAACTGGCTGCGTCTATTGCCTTTAAAGAAGGCTTTAAGAAGGCAAAACCAGTTCTGCTT
GAGCCGATCATGAAGGTTGAAGTAGAAACTCCGGAAGAGAACACTGGTGATGTTATCGGT
GACTTGAGCCGTCGTCGCGGT

Sequence comparison:

This page was design for assignation of sequence type (ST) of K. variicola isolates, both for Sanger- and for whole genome-type sequencing technologies. In the case of whole genome sequencing we included, first, the ANI (average nucleotide identity; see references below) analysis for proper identification of bacterial species as: K. variicola, K. pneumoniae, K. quasipneumoniae and K. quasivariicola (this last recently described). Only for K. variicola genomes will be determined the sequence tape (ST). In the other cases determines which of the other species corresponds to those included in the analysis.

This considering the following references:

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.
Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. 2007.
Int J Syst Evol Microbiol 57:81–91. 10.1099/ijs.0.64483-0.

Taxonomic affiliation of new genomes should be verified using average nucleotide identity and multilocus phylogenetic analysis.
Figueras MJ, Beaz-Hidalgo R, Hossain MJ, Liles MR. 2014.
Genome Announc. 4;2. pii: e00927-14. doi: 10.1128/genomeA.00927-14

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :56-62.

Download sequences and ST table:

ST table:

ST Origin Sample ESBL/Carba-
penemase		 Country Accession Strain leuS pgi pgk phoE pyrG rpoB fusA
1 Human Blood SHV-2 Mexico CDMV00000000 801 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 805 1 1 1 1 1 1 1
1 Human Blood SHV-2 Mexico 25886267 806 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 807 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 808 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 809 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 811 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 812 1 1 1 1 1 1 1
1 Human Urine Negative USA QIYN01000001.1 WUSM_KV_09 1 1 1 1 1 1 1
2 Human Sputum Negative Mexico CEGG00000000 8917 1 2 2 1 2 1 2
3 Plant Banana root Negative Mexico CXPC00000000 6A2 1 3 3 2 3 1 3
3 Human Blood Negative Italy UJZQ01000001.1 EuSCAPE_IT012 1 3 3 2 3 1 3
3 Human Blood Negative Serbia UKAM01000001.1 EuSCAPE_RS065 1 3 3 2 3 1 3
4 Human Abscess CTX-M-15 Mexico CXOZ00000000 06-268 1 1 4 2 4 2 2
5 Human Blood Negative Mexico CXPB00000000 4880 1 4 5 3 1 1 4
6 Plant Sugar cane stem Negative Mexico CXPA00000000 T29A 2 5 6 4 5 1 2
7 Insect Fungus matrix Negative Panama CP001891.1 At-22 3 1 7 1 6 3 4
8 Plant Maize stems Negative USA CP000964.1 342 1 6 8 5 7 1 5
9 Plant Banana roots Negative China CP009274 DX120E 1 6 9 1 8 1 2
10 Human Gut Negative Denmark CBBA000000000 CAG:634 1 4 10 6 9 1 2
10 Human Blood SHV-12 (LEN-type negative) China CP030173.1 13450 1 4 10 6 9 1 2
10 Human Wound swab Negative Tanzania OVDM01000001.1 KCRI-198C 1 4 10 6 9 1 2
10 Human Sputum Negative Tanzania OVDP01000001.1 KCRI-201B 1 4 10 6 9 1 2
10 Human Respiratory SHV-30 USA SRX2681986 KPN1264 1 4 10 6 9 1 2
10 Human Urine Negative USA QIXS01000001.1 WUSM_KV_30 1 4 10 6 9 1 2
10 Human Urine Negative USA QIXM01000001.1 WUSM_KV_36 1 4 10 6 9 1 2
11 plant Banana root Negative China CP010523 DSM15968 4 7 5 1 10 1 4
11 Plant Banana root Negative Mexico 15053318 F2R9 (ATCC BAA-830) 4 7 5 1 10 1 4
12 Human Faeces negative Braziil JDWA00000000 BZ19 5 8 11 1 11 1 4
13 Insect Nezara viridula (Cotton Pathogen Vector; southern green stink bug) negative USA CP008700.1 KP5-1 6 6 4 7 11 1 2
14 Human Pus CTX-M-15/KPC-6 Malaysia JRTV00000000 223/14 7 3 6 8 12 4 3
15 Plant Bitter gourd negative Malaysia JSWX00000000 B1 8 4 12 9 1 1 2
16 Plant Chili negative Malaysia JSXA00000000 CH4 9 3 12 8 3 5 2
16 Human Urine negative USA JMWB00000000 BIDMC61 9 3 12 8 3 5 2
17 Human Respiratory negative USA AYJK00000000 MGH20 1 1 1 1 4 1 2
18 missing Urine negative USA AYIX00000000 MGH40 10 9 6 1 13 1 6
19 missing missing negative USA AYIF00000000 UCICRE10 1 4 1 1 11 1 2
20 Human Urine negative USA JCML00000000 UCI18 1 10 2 10 14 1 2
20 Human missing negative USA LFAP00000000 MGH114 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDW01000001.1 ID_2 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDT01000001.1 ID_5 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDV01000001.1 ID_6 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDM01000001.1 ID_8 1 10 2 10 14 1 2
20 Human Urine negative Belgium UKAV01000001.1 EuSCAPE_BE029 1 10 2 10 14 1 2
20 Human Unknown negative Germany UIDI01000001.1 ID_11 1 10 2 10 14 1 2
20 Human Urine negative USA QIXC01000001.1 WUSM_KV_46 1 10 2 10 14 1 2
21 Human Urine negative USA JMZD00000000 MGH68 11 5 5 11 11 1 2
22 Human Urine negative USA JMZM00000000 MGH80 11 3 6 12 11 6 4
23 Human missing negative USA LFBA00000000 BIDMC88 1 11 10 6 9 1 2
24 Human missing negative USA LFBC00000000 BIDMC90 12 12 10 1 15 1 4
25 Human missing negative USA LFAD00000000 MGH92 9 13 13 13 7 1 4
26 Human missing negative USA ACXA00000000 1.1.55 9 10 13 13 7 1 4
27 Human missing negative USA ASQN00000000 KTE92 11 6 5 1 16 4 4
28 Human Blood negative Mexico 15053318 1109 1 1 4 2 17 2 2
29 Human Catheter negative Mexico 15053318 1171 1 4 3 14 18 1 3
30 Human Secretion negative Mexico 25886267 9351 1 14 5 1 19 1 4
31 Human Biliary liquids negative Mexico 25886267 9353 13 15 1 1 20 1 2
32 Human Abscess negative Mexico 25886267 9925 14 16 14 15 21 7 2
32 Human Blood negative Mexico 26571390 10239 14 16 14 15 21 7 2
32 Human Sputum negative USA JVTE01000001 1335_KPNE 14 16 14 15 21 7 2
32 Human Blood negative USA SRX2682028 KPN700 14 16 14 15 21 7 2
32 Human Other (CAPD) negative Portugal UJZY01000001.1 EuSCAPE_PT079 14 16 14 15 21 7 2
33 Plant Banana stem negative Mexico 15053318 VI 15 6 15 1 22 1 2
34 Plant Rice roots negative Mexico 15053318 CFN2006 1 3 5 16 1 8 2
35 Human Vaginal secretion negative Mexico 29692906 10447 16 1 5 1 1 1 6
36 Human missing negative Mexico This work 9271 1 4 16 2 23 9 2
37 Human missing negative Mexico This work 9274 17 17 1 1 24 1 5
37 Human Wound, drain right lower quadrant negative Mexico QIYH01000001.1 WUSM_KV_15 17 17 1 1 24 1 5
38 Human missing negative Mexico This work 11212 1 4 10 6 1 1 2
39 Human missing negative Mexico This work 11214 11 6 13 2 25 3 4
40 Human missing negative Mexico This work 11226 1 18 17 17 1 10 2
41 Human missing negative Mexico This work 11248 2 5 10 1 1 1 2
41 Environmental Soil negative Singapore CP013985.1 LMG23571 2 5 10 1 1 1 2
42 Human Sputum negative Mexico This work 11254 18 6 4 1 1 6 2
43 Human missing negative Mexico This work 11435 17 17 1 1 26 1 5
44 Human missing negative Mexico This work 11463 12 19 13 1 27 1 4
45 Human missing negative Mexico This work 11436 1 1 6 18 28 1 4
46 Plant Sugarcane rhizosphere soil negative Mexico This work KvMx3 2 5 18 19 1 1 2
47 Plant Sugarcane rhizosphere soil negative Mexico This work KvMx4 19 15 6 20 22 1 6
48 Plant Maize rhizosphere soil negative Mexico This work KvMx18 11 10 19 1 4 1 2
49 Human Sputum negative USA JVDU01000001.1 521_SSON 1 20 6 21 1 7 2
49 Human Bronchoalveolar Lavage negative USA JVDR01000001.1 524_SBOY 1 20 6 21 1 7 2
42 Human Sputum negative USA JUYL01000001.1 653_KVAR 1 20 6 21 1 7 2
50 Human Fluid negative USA JUXS01000001.1 671_KVAR 1 3 6 22 3 8 2
51 Human Tracheal Aspirate negative USA JUTF01000001.1 780_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURI01000001.1 833_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURH01000001.1 834_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURG01000001.1 835_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURF01000001.1 836_KPNE 1 20 1 23 29 9 4
51 Human Tracheal Aspirate negative USA JURE01000001.1 837_KPNE 1 20 1 23 29 9 4
51 Human Urine catheter negative USA QIYM01000001.1 WUSM_KV_10 1 20 1 23 29 9 4
52 Human Urine, Catheterized negative USA JUSW01000001.1 789_KVAR 1 4 3 24 11 1 2
53 Human Body fluid KPC-2 USA PTGT01000001.1 1565/2503 1 21 1 25 30 11 4
54 Human Unknown negative Vietnam ERR025463 1892m 1 5 5 1 1 1 2
54 Human missing negative USA NGSP01000001.1 BIDMC118 1 5 5 1 1 1 2
55 Human missing negative Mexico This work 11446 20 22 20 26 31 12 7
56 Human Unknown negative Australia ERS005747 AJ026 21 18 3 2 1 13 2
56 Human Unknown negative Australia ERS005771 AJ182 21 18 3 2 1 13 2
56 Human Trach asp negative USA QIYS01000001.1 WUSM_KV_04 21 18 3 2 1 13 2
56 Human Urine negative USA QIYF01000001.1 WUSM_KV_17 21 18 3 2 1 13 2
56 Human Urine negative USA QIXD01000001.1 WUSM_KV_45 21 18 3 2 1 13 2
57 Human Unknown negative Australia ERS005754 AJ135 22 6 6 27 1 1 8
57 Human Blood CTX-M-15/OXA-1 Netherlands JXJH01000001.1 KP-21F 22 6 6 27 1 1 8
58 Human Unknown negative Australia ERS005778 AJ292 6 4 1 28 32 14 2
59 missing missing negative USA MPCI01000001.1 AR_0016 23 19 5 29 2 1 4
59 Human Urine negative USA QIXW01000001.1 WUSM_KV_26 23 19 5 29 2 1 4
60 Human Blood CTX-M-15 Bangladesh QUAA01000001.1 BD.DM.32 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZQ01000001.1 BD.DM.33 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZR01000001.1 BD.DM.97 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZS01000001.1 BD.DM.115 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh PJOO01000001.1 BD.DM.165 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZT01000001.1 BD.DM.166 11 6 5 30 16 4 4
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZU01000001.1 BD.DM.167 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZV01000001.1 BD.DM.169 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZW01000001.1 BD.DM.322 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZX01000001.1 BD.DM.323 11 6 5 30 16 4 4
60 Human Blood CTX-M-15 Bangladesh QTZY01000001.1 BD.DM.395 11 6 5 30 16 4 4
61 Human missing KPC-2 USA NGSO01000001.1 BIDMC117 1 9 6 1 13 1 6
61 Human Urine negative USA QIXP01000001.1 WUSM_KV_33 1 9 6 1 13 1 6
62 Plant Roots of tall fescue negative China LOAR00000000 D5A 10 9 6 1 32 1 6
62 Human Unknown negative Germany UIDS01000001.1 ID_24 10 9 6 1 32 1 6
63 Plant Roots Maize negative China NZ_CP016344.1 E57-7 9 3 12 31 3 5 2
64 Environmental river water NDM-9 South Korea NZ_CP017284.1 GJ1 1 3 6 8 11 1 9
64 Environmental river water NDM-9 South Korea NZ_CP017849.1 GJ2 1 3 6 8 11 1 9
64 Environmental river water CTX-M-65/NDM-9 South Korea NZ_CP017289.1 GJ3 1 3 6 8 11 1 9
65 Human Unknown CTX-M-148 China MOSU00000000 H39 24 3 1 32 33 15 4
65 Human Pulmonary CTX-M-24 (two copies) China CP018307 X39 24 3 1 32 33 15 4
66 Human Unknown negative Germany UIDY01000001.1 ID_16 13 23 5 33 19 1 10
66 Human Unknown negative Germany UIDU01000001.1 ID_18 13 23 5 33 19 1 10
66 Human Unknown negative Germany UIEF01000001.1 ID_19 13 23 5 33 19 1 10
67 Human Unknown negative Germany UIFG01000001.1 ID_43 13 23 5 34 19 1 10
68 Human Unknown negative Germany UIFD01000001.1 ID_49 1 18 6 1 34 13 2
68 Human Blood negative Croatia UKAN01000001.1 EuSCAPE_HR085 1 18 6 1 34 13 2
69 Human Blood DHA-1, SHV-12, CTX-M-14, KPC-2 Bangladesh NPGY01000001.1 K2631 25 21 3 35 35 1 2
70 Human Wound swab negative Tanzania OVDF01000001.1 KCRI-152E 26 10 1 36 1 13 2
71 Human Catheter KPC-2 Colombia MSZI01000001.1 KP007 9 4 6 24 1 1 2
72 Human Urine SHV-12 USA SRX2681305 KPN325 19 5 5 6 10 1 2
73 Human Blood SHV-12 USA SRX2680563 KPN458 11 9 6 20 1 13 2
73 Human Urine negative USA QIXA01000001.1 WUSM_KV_48 11 9 6 20 1 13 2
74 Human Urine CTX-M-15 USA SRX2681541 KPN807 27 4 3 1 35 1 2
75 Human Respiratory KPC-2 USA SRX2681803 KPN1401 1 1 15 1 1 11 4
75 Human Respiratory TEM-69/KPC-2 USA SRX2681790 KPN1415 1 1 15 1 1 11 4
76 Human Urine CTX-M-15/NDM-1 USA SRX2681713 KPN1481 28 24 5 37 36 1 2
77 Human Wound SHV-12 USA SRX2681646 KPN1556 11 1 3 1 11 1 2
77 Human Urine negative USA QIWX01000001.1 WUSM_KV_51 11 1 3 1 11 1 2
78 Human Urine SHV-12/SHV-66 USA SRX2681570 KPN1751 1 6 10 3 37 1 4
78 Human Urine negative Belgium UKAP01000001.1 EuSCAPE_BE032 1 6 10 3 37 1 4
79 Human Urine negative India LZGB01000001.1 KV093 15 6 1 1 38 14 4
80 Plant/Fungus Mycorrhiza of Pisolithus tinctorius negative China LQMR01000001.1 KV321 29 4 6 1 1 14 4
81 Human Catheter negative Mexico This work 9635 2 6 12 38 39 16 4
82 Plant Root of a sugarcane plant negative Mexico FLLH01000001 KvMx2 30 25 21 39 40 17 4
83 Human Faeces negative China NLDD01000001 L18 31 24 22 40 41 1 11
84 Environmental Industrial effluent negative Pakistan MSCS01000001 MB351 11 26 2 41 1 1 6
85 Animal Bovine - Mastitis negative Canada LFYK01000000 NL58 1 10 14 42 2 13 6
85 Animal Bovine - Mastitis negative Canada LGAW01000000 NL49 1 10 14 42 2 13 6
86 Animal Bovine - Intestinal negative USA ERS011908 QMP_B2-288 11 27 5 41 1 1 6
86 Human Urine negative Greece UKAQ01000001.1 EuSCAPE_GR014 11 27 5 41 1 1 6
87 Animal Bovine - Intestinal negative USA ERS011920 QMP_B2-340 13 28 3 9 1 1 2
87 Animal Bovine - Intestinal negative USA ERS011926 QMP_B2-483 13 28 3 9 1 1 2
88 Animal Bovine - Intestinal negative USA ERS011925 QMP_B2-481 2 1 3 38 4 18 6
89 Animal Bovine - Intestinal Negative (LEN-type negative) USA ERS011933 QMP_M1-043 1 17 1 25 42 1 4
90 Animal Unknown negative USA ERS011961 QMP_M1-428 32 29 3 24 35 19 4
91 Animal Urine Negative (LEN-type negative) USA ERS011977 QMP_M1-893 33 6 1 11 43 1 4
92 Human missing CTX-M-15/KPC-2 China PWAV01000001.1 SCKV020062 1 6 23 43 1 1 4
92 Human missing CTX-M-15/KPC-2 China PWAU01000001.1 SCKV020067 1 6 23 43 1 1 4
92 Human missing CTX-M-15/KPC-2 China PWAT01000001.1 SCKV020069 1 6 23 43 1 1 4
92 Human Unknown negative China NZ_CP028555.1 WCHKP19 1 6 23 43 1 1 4
93 Human missing NDM-5 China NWEW01000001.1 SCKV020148 1 3 3 2 3 20 3
94 Human missing CTX-M-15 South Africa NXJG01000001.1 ST-1791-KOO1 34 6 6 1 35 1 4
95 Environmental GM-anode biofilm negative missing DBMQ01000001.1 UBA694 18 24 5 1 1 1 4
96 Environmental Metal/Plastic negative USA DFSA01000001.1 UBA3449 11 4 10 6 44 8 2
97 Environmental Metal/Plastic negative USA DGAC01000001.1 UBA4040 13 24 6 30 1 1 2
98 Human Unknown negative China NZ_CP027064.2 WCHKV030666 28 30 5 37 1 1 2
99 Human Unknown negative China NWEJ01000001.1 WCHKV030937 35 4 6 1 1 1 2
100 Human Urine negative USA QIYV01000001.1 WUSM_KV_01 6 24 5 1 1 1 4
101 Human Unknown negative USA QIYV01000001.1 WUSM_KV_02 2 5 6 3 5 1 2
102 Human Aspirate, left breast negative USA QIYT01000001.1 WUSM_KV_03 23 19 2 8 45 1 2
103 Human Sputum negative USA QIYQ01000001.1 WUSM_KV_06 36 6 10 3 37 1 4
103 Human Urine negative USA QIXK01000001.1 WUSM_KV_38 36 6 10 3 37 1 4
103 Human Wound negative USA QIWZ01000001.1 WUSM_KV_49 36 6 10 3 37 1 4
103 Human Blood negative Germany UJZE01000001.1 EuSCAPE_DE052 36 6 10 3 37 1 4
104 Human Urine negative USA QIYP01000001.1 WUSM_KV_07 2 27 6 2 1 13 6
105 Human Drainage, left groin negative USA QIYO01000001.1 WUSM_KV_08 2 6 1 25 32 11 2
105 Human Tibia negative USA QIYL01000001.1 WUSM_KV_11 2 6 1 25 32 11 2
105 Human Urine negative Italy UJZU01000001.1 EuSCAPE_IT360 2 6 1 25 32 11 2
106 Human Urine negative USA QIYK01000001.1 WUSM_KV_12 5 31 5 44 46 13 2
107 Human Urine negative USA QIYJ01000001.1 WUSM_KV_13 37 32 1 3 37 7 4
108 Human Blood negative USA QIYI01000001.1 WUSM_KV_14 38 33 24 45 47 1 6
108 Human Urine negative USA QIYD01000001.1 WUSM_KV_19 38 33 24 45 47 1 6
109 Human Blood negative USA QIYG01000001.1 WUSM_KV_16 39 1 1 1 1 1 1
110 Human Urine negative USA QIYE01000001.1 WUSM_KV_18 11 1 6 46 48 2 4
111 Human Urine negative USA QIYB01000001.1 WUSM_KV_21 40 27 6 3 1 13 6
112 Human Urine negative USA QIYA01000001.1 WUSM_KV_22 41 5 6 8 4 2 2
112 Human Urine negative USA QIXZ01000001.1 WUSM_KV_23 41 5 6 8 4 2 2
112 Human Blood negative USA QIXY01000001.1 WUSM_KV_24 41 5 6 8 4 2 2
113 Human Blood negative USA QIXX01000001.1 WUSM_KV_25 14 1 6 1 36 1 2
113 Human Urine negative USA QIXN01000001.1 WUSM_KV_35 14 1 6 1 36 1 2
114 Human Urine negative USA QIXV01000001.1 WUSM_KV_27 1 28 6 43 49 13 2
115 Human Urine negative USA QIXU01000001.1 WUSM_KV_28 11 23 6 1 35 1 10
116 Human Urine negative USA QIXT01000001.1 WUSM_KV_29 2 4 6 24 4 21 2
116 Human Urine negative USA QIXQ01000001.1 WUSM_KV_32 2 4 6 24 4 21 2
117 Human Urine negative USA QIXR01000001.1 WUSM_KV_31 42 1 3 47 1 7 12
118 Human Urine negative USA QIXL01000001.1 WUSM_KV_37 41 5 6 8 35 2 2
119 Human Urine negative USA QIXJ01000001.1 WUSM_KV_39 1 18 12 1 34 12 2
120 Human Urine negative USA QIXH01000001.1 WUSM_KV_41 35 27 6 3 1 13 6
121 Human Urine negative USA QIXE01000001.1 WUSM_KV_44 38 34 1 1 35 1 10
122 Human Bronchial wash negative USA QIWY01000001.1 WUSM_KV_50 5 8 7 40 11 11 4
123 Human Urine negative USA QIWW01000001.1 WUSM_KV_52 1 3 12 1 1 10 2
124 Human Urine negative USA QIWV01000001.1 WUSM_KV_53 9 4 5 1 32 13 4
125 Human Blood CTX-M-14/KPC-2 USA QIWU01000001.1 WUSM_KV_54 43 1 3 38 4 1 4
125 Human Urine negative Austria UJZA01000001.1 EuSCAPE_AT005 43 1 3 38 4 1 4
126 Human BAL negative USA QIWT01000001.1 WUSM_KV_55 1 19 1 38 1 1 4
127 Human UR CVS negative USA QIVS01000001.1 WUSM_KV_82 1 10 6 45 22 7 6
128 Human Blood negative USA QIVD01000001.1 WUSM_KV_97 1 35 1 48 35 1 2
129 Human Blood negative USA QIUP01000001.1 WUSM_KV_111 13 6 6 41 50 2 4
130 Human missing SHV-40/KPC-2 USA PGIO01000001.1 YD626-2 1 4 5 6 9 1 2
131 Plant Potato negative Japan AP014950.1 YH43 44 22 20 49 51 22 7
132 Human Puncture Fluids negative Belgium UKAT01000001.1 EuSCAPE_BE101 28 30 3 37 1 1 2
133 Human Other (gall bladder) negative Germany UJZJ01000001.1 EuSCAPE_DE018 13 15 1 1 22 1 2
134 Human Wound Secretion negative Germany UJZI01000001.1 EuSCAPE_DE056 2 4 3 38 52 18 4
135 Human Wound Secretion negative Germany UJZK01000001.1 EuSCAPE_DE060 11 1 5 41 53 1 6
136 Human Blood KPC-2 Germany UJZM01000001.1 EuSCAPE_DE073 11 36 6 1 1 6 2
137 Human Lower Respiratory Tract Secrection negative Germany UJZL01000001.1 EuSCAPE_DE087 9 24 16 50 1 13 2
138 Human Blood negative Denmark UJZZ01000001.1 EuSCAPE_DK012 45 37 25 8 11 23 13
139 Human Wound Secretion negative Estonia UJZB01000001.1 EuSCAPE_EE016 1 6 18 29 1 7 4
140 Human Puncture Fluids SHV-1 (not ESBL) Spain UJZX01000001.1 EuSCAPE_ES230 11 27 2 51 53 4 2
141 Human Blood negative Francia UJZD01000001.1 EuSCAPE_FR080 1 4 5 1 15 1 14
142 Human Lower Respiratory Tract Secrection negative Croatia UKAG01000001.1 EuSCAPE_HR006 9 17 13 3 7 1 4
143 Human Lower Respiratory Tract Secrection negative Croatia UKAR01000001.1 EuSCAPE_HR033 11 24 18 52 54 3 2
144 Human Blood negative Hungary UJZW01000001.1 EuSCAPE_HU040 1 3 6 8 11 1 2
144 Human Urine negative Portugal UKAH01000001.1 EuSCAPE_PT061 1 3 6 8 11 1 2
145 Human Blood negative Ireland UKAL01000001.1 EuSCAPE_IE014 1 10 6 25 11 13 6
146 Human Blood negative Ireland UKAZ01000001.1 EuSCAPE_IE021 1 4 5 2 9 1 2
146 Human Blood negative United Kingdom UKAE01000001.1 EuSCAPE_UK107 1 4 5 2 9 1 2
147 Human Blood negative Israel UJZN01000001.1 EuSCAPE_IL071 11 28 6 43 55 13 2
148 Human Urine negative Italy UJZV01000001.1 EuSCAPE_IT091 28 3 5 53 1 1 2
149 Human Lower Respiratory Tract Secrection negative Italy UJZP01000001.1 EuSCAPE_IT159 5 38 5 44 46 13 2
150 Human Urine negative Italy UJZR01000001.1 EuSCAPE_IT191 1 17 14 10 39 1 4
151 Human Blood negative Italy UJZO01000001.1 EuSCAPE_IT251 1 18 12 1 56 1 2
152 Human Blood negative Italy UKAC01000001.1 EuSCAPE_IT309 2 39 1 12 1 2 4
153 Human Urine negative Italy UJZT01000001.1 EuSCAPE_IT344 1 18 12 1 1 10 2
154 Human Urine negative Italy UJZS01000001.1 EuSCAPE_IT389 1 3 6 12 3 24 15
155 Human Urine negative Norway UJZH01000001.1 EuSCAPE_NO020 9 40 1 54 57 1 5
156 Human Urine negative Poland UJZC01000001.1 EuSCAPE_PL033 46 28 16 38 58 16 4
157 Human Urine negative Portugal UKAA01000001.1 EuSCAPE_PT077 47 41 1 13 13 1 5
158 Human Puncture Fluids SHV-1 (not ESBL) Romania UKAJ01000001.1 EuSCAPE_RO063 11 5 12 1 59 4 2
159 Human Pus negative Romania UKAK01000001.1 EuSCAPE_RO090 2 4 3 38 4 18 4
160 Human Blood SHV-12, OXA-9 Serbia UKAO01000001.1 EuSCAPE_RS096 1 18 3 1 1 13 2
161 Human Puncture Fluids OXA-1 (not ESBL) Slovenia UKAB01000001.1 EuSCAPE_SI005 31 42 26 20 1 25 4
162 Human Urine negative Slovenia UKAD01000001.1 EuSCAPE_SI024 38 24 6 1 35 1 10
163 Human Urine negative Turkey UKAS01000001.1 EuSCAPE_TR218 13 1 6 1 1 13 4
164 Human Urine CTX-M-3 Turkey UKAU01000001.1 EuSCAPE_TR259 1 6 5 1 32 1 2
165 Human Urine negative United Kingdom UKAF01000001.1 EuSCAPE_UK089 16 1 5 41 34 1 6
166 Human Urine negative United Kingdom UKAI01000001.1 EuSCAPE_UK124 48 4 3 1 60 4 2
167 Animal (migratory bird) unknown unknown Brazil in process M50 1 36 12 1 1 1 2

Who is Klebsiella variicola?

K. variicola is a Gram-negative, facultative anaerobic, non-spore-forming, non-motile rod. Its form is circular, convex and smooth colonies and grows around 11-41ºC. K. variicola was initially identified as endophyte in plants and pathogen in humans. However, according to different reports it could be considered ubiquitous in nature. According to its description in the literature, K. variicola can be found in soil, water, plants, insects, humans and animals. In all of them K. variicola plays different roles as; endophyte in plants, as pathogen in humans and animals and symbiont in insects.

Recent publication about K. variicola:

Klebsiella variicola: a pathogen and eco-friendly bacteria with applications in biolgical and industrial processes.
Duran-Bedolla,J., Garza-Ramos,U., Rodriguez-Medina,N., Aguilar-Vera Alejandro & Barrios-Camacho,H. Applied and Environmental Microbiology. under review (2019).

Klebsiella variicola: an emerging pathogen in humans.
Rodríguez-Medina Nadia, Barrios-Camacho Humberto, Duran-Bedolla Josefina, Garza-Ramos Ulises. Emerging Microbes and Infection. 2019;8(1):973-988. doi: 10.1080/22221751.2019.1634981. Download

Phenotypic and molecular characterization of Klebsiella spp. isolates causing community-acquired infections.
Garza-Ramos U, Barrios-Camacho H, Moreno-Domínguez S, Toribio-Jiménez J, Jardón-Pineda D, Cuevas-Peña J, Sánchez-Pérez A, Duran-Bedolla J, Olguín-Rodriguez J, Román-Román A. New Microbes New Infect. 2018 Feb 17;23:17-27. Download

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :29-40. Download

Klebsiella variicola and Klebsiella quasipneumoniae genomic analysis provides insights into their capacity to adapt to clinical and plant settings.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jeiry Toribio-Jimenez, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :56-62. Download

Hypervirulence and hypermucoviscosity: Two different but complementary Klebsiella spp. phenotypes?
Catalán-Nájera JC, Garza-Ramos U, Barrios-Camacho H. Virulence. 2017. Oct 3;8(7):1111-1123. Download

Identification and Characterization of Imipenem-Resistant Klebsiella pneumoniae and Susceptible Klebsiella variicola Isolates Obtained from the Same Patient.
Garza-Ramos U*, Moreno-Dominguez S, Hernández-Castro R, Silva-Sanchez J, Barrios H, Reyna-Flores F, Sanchez-Perez A, Carrillo-Casas EM, Sanchez-León MC, Moncada-Barron D.. Microb Drug Resist. 2016 Apr;22(3):179-84. Download

Draft genome sequences of the Klebsiella variicola plant isolates.
Martinez-Romero Esperanza, Jesús Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesús Martínez-Barnetche, Juan Téllez-Sosa, Rosa Elena Gómez-Barreto, Ulises Garza-Ramos. Genome Announc. 2015 Sep 10;3(5). Download

Draft genome sequence of the first hypermucoviscous Klebsiella variicola clinical isolate.
Ulises Garza-Ramos; Jesus Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesus Martínez-Barnetche, Veronica Andrade. Genome Announc. 2015 Apr 9;3(2). Download

Development of a multiplex-PCR probe system for proper identification of Klebsiella variicola.
Ulises Garza-Ramos, Jesús Silva-Sánchez, Esperanza Martínez-Romero, Perla Tinoco, Marisol Pina-Gonzales, Humberto Barrios, Jesús Martínez-Barnetche, Rosa elena Gomez-Barreto, Juan Tellez. BMC Microbiol. 2015 Dec;15(1):396. Download

SUBMISSIONS

In order to function as such a resource and to maintain the quality of the data, the databases are hand curated, and all entries will be checked before final entry into the main database.

To submit your data please contact the curators directly.

Dr. Ulises Garza Ramos
email: ulises.garza@insp.mx

Dr. Humberto Barrios Camacho
email: humberto.barrios@insp.mx
INSTITUTO NACIONAL DE SALUD PÚBLICA, MÉXICO - DERECHOS RESERVADOS © 2019
Av. Universidad No. 655 Colonia Santa María Ahuacatitlán, Cerrada Los Pinos y Caminera C.P. 62100, Cuernavaca, Morelos. México. Tel. (777) 329 3000
Contact: webmaster_kv@insp.mx
View My Stats