Allelic profile:

leuS pgi pgk phoE pyrG rpoB fusA



Which ST profile has your sequence?, Select your fasta file:


Run average nucleotide identity (ANI)



Enter Query Sequence:





Database developed by the Centro de Investigación Sobre Enfermedades Infecciosas (CISEI) in collaboration with the Centro de Ciencias Genómicas (CCG-UNAM). This site has been funded by the Instituto Nacional de Salud Pública (INSP).

Reference for citations of MLST of K. variicola:

Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises. Scientific Reports. 2019. Molecular epidemiology of Klebsiella variicola obtained from different sources.


Reference for citations of MLST of K. variicola:

Molecular epidemiology of Klebsiella variicola obtained from different sources.
Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises.
Scientific Reports. 2019.

Protocol used for MLST of Klebsiella variicola.

Genes of MLST:
leuS(Leucyl-tRNA synthethase)
pgi(Phosphoglucose iomerase)
pgk(Phosphoglycerate kinase)
phoE(Phosphoporine E)
pyrG(CTP synthase)
rpoB(β-subunit of RNA polymerase B)
fusA(Elongation factor G)

PCR Amplification:
Gene/primerSequence (5’-3’)Annealing (Tm)Amplification Product
leuSKv-FCGAACAGGTTATCGACGGCT63 °C968 bp
leuSKv-RCAAAGGTGTCGGTTTCACGC
pgiKv-FAAAGAGACCGATCTGGCAGG60 °C760 bp
pgiKv-RACCAGATACCGATCAGCGCC
pgkKv-FTCGTGATGGATGCTTTCGGT63 °C663 bp
pgkKv-RAGATTTTGTCAGCGATGCCG
phoEKv-FCTGTACGACGTGGAAGCCTG63 °C613 bp
phoEKv-RCCACGAAGGCGTTCATGTTT
pyrGKv-FCCGATCGCTATGGTCGCTG60 °C664 bp
pyrGKv-RCGGGACATCAGTTCCGGGT
rpoBKv-FGCCAGCTGTCCCAGTTTATG60 °C648 bp
rpoBKv-RGAACGGTACCGCCACGTTTA
fusAKv-FGGGGCTGCTTTATACCTCGG60 °C782 bp
fusAKv-RTGATAGTCATCGTCACGCCG

Conditions of amplification:

PCR: 3 min at 96°C; 30 cycles of 1 min at 95°C; 30 seg annealing temperature (60°C or 63°C according of amplification gene); 1 min at 72°C. Following 7 min at 72°C.

PCR reaction:
Each reaction contains 10ng of chromosomal DNA, 12.5 pmol of each primer, 25mM of the dNPTs, 1X of PCR Buffer, 1 unit of Taq polymerase and water to 50 ml.

Sequencing of PCR products:
The primer used by PCR amplification were used by Sanger sequencing step

Allele template. Allelic profile of K. variicola 801 (GenBank: CDMV01000001):
leuS (594 bp)
GATCACTGGCCAGACACCGTAAAGACCATGCAGCGCAACTGGATCGGCCGTTCCGAAGGG
GTGGAAATCTCCTTTGACGTCAACAACTACGCCGATAAGCTGACCGTCTACACCACCCGT
CCGGACACCTTTATGGGCTGCACCTACCTGGCTGTCGCGGCGGGTCACCCGCTGGCGCAG
CAGGCTGCAGCGAACAATCCGGCGCTGGCTGCCTTTATCGACGAATGCCGTAATACCAAA
GTAGCCGAAGCCGACATGGCGACGATGGAGAAAAAAGGCGTCGATACCGGGTTTAAAGCC
ATTCACCCGCTGACCGGCGAAGAAATTCCTGTCTGGGCGGCAAACTTCGTGCTGATGGAA
TATGGCACCGGCGCGGTCATGGCCGTTCCGGGTCACGACCAGCGTGACTATGAGTTCGCC
AGCAAGTACGGTCTGAACATCAAGCCGGTTATCCTCGCCGCTGACGGCAGCGAGCCGGAT
CTCTCCGCGCAGGCGCTGACCGAGAAAGGCGTCCTGTTTAACTCCGGCGAGTTCAGCGGC
CTCGATTATGAAGCCGGCTTCAACGCCATTGCCGACAAACTGGCAGCCATGGGC

pgi (600 bp)
GACCGTGCGGTACTGCACGTCGCGCTGCGCAACCGCAGCAATACGCCGATTGTGGTTGAT
GGCAAAGATGTGATGCCGGAAGTGAACGCTGTGCTGGAGAAGATGAAAACCTTCTCAGAA
GCGATTATCTCCGGTAGCTGGAAAGGCTATACCGGCAAACCGATCACCGACGTGGTTAAC
ATTGGTATCGGCGGTTCCGACCTCGGTCCGTTCATGGTCACCGAAGCGCTGCGTCCGTAC
AAAAACCACCTCAACATGCACTTTGTCTCCAACGTCGATGGCACCCACATCGCTGAAGTG
CTGAAGAACGTCAACCCGGAAACGACCCTGTTCCTGGTGGCGTCCAAGACCTTCACCACT
CAGGAAACCATGACCAACGCCCACAGCGCGCGCGACTGGTTCCTGGCGACCGCGGGCGAC
GACAAACACGTGGCCAAACACTTCGCGGCGCTTTCTACCAACGCGAAAGCGGTTGGCGAG
TTCGGCATCGACACCGCCAACATGTTTGAATTCTGGGACTGGGTTGGCGGCCGTTACTCC
CTGTGGTCGGCGATTGGCCTGTCCATCATTCTCTCCGTGGGCTTCGACAACTTCGTTGAG

pgk (444 bp)
GCGTGCGCAGGCCCGCTGCTGGCCGCTGAACTGGACGCGCTGGGTAAAGCGCTGAAAGAG
CCGGCTCGTCCGATGGTCGCTATCGTGGGTGGTTCTAAAGTGTCCACCAAACTGACCGTG
CTGGATTCCCTGTCTAAAATCGCTGACCAGCTGATCGTCGGCGGCGGTATCGCCAACACC
TTCGTTGCTGCCCAGGGCCACAACGTCGGTAAATCCCTGTACGAAGCAGACCTGGTTGAT
GAAGCTAAGCGCCTGCTGAGCACCTGTGATATCCCGGTTCCGACGGACGTTCGCGTCGCG
ACCGAGTTCTCCGAAACCGCAACGGCAACCCTGAAATCTGTTAACGACATCAAAGATGAC
GAGCAGATTCTGGACCTTGGCGACGTTTCCGCACAGAAACTGGCCGACATCCTGAAAAAC
GCCAAAACCATCCTGTGGAACGGC

phoE (453 bp)
GATTCCTCTGCCCAGACCGATAACTTTATGACCAAACGCGCCAGCGGCCTGGCGACCTAC
CGCAATACCGATTTCTTCGGTCTGGTGGATGGTCTGGATATGACCCTGCAGTACCAGGGT
AAAAACGAAGGCCGTGAAGCGAAGAAACAGAACGGCGACGGCGTTGGCACCTCATTAAGC
TATGATTTCGGCGGCAGCGACTTCGCCGTCAGCGCGGCCTACACCAGCTCCGACCGTACC
AACGATCAGAACCTGCTGGCCCGCGGCCAGGGTTCGAAAGCGGAAGCCTGGGCGACCGGC
CTGAAATATGACGCCAACAATATCTACCTGGCGACCATGTATTCTGAGACCCGCAAAATG
ACCCCGATCAGCGGCGGTTTTGCCAACAAAGCGCAGAACTTTGAAGCGGTGGCGCAGTAT
CAGTTCGACTTCGGTCTGCGTCCGTCCCTCGGC

pyrG (522 bp)
ACGTCCTTGCGCATCGCACTGATTGGCCGTGAGTCAGACCACCGTCTGGTCTACCCCGCC
ACGCTTGGCTCACTGGGTGATGCCGCGGCGTCGCTGGGGCTGAACCTGGAGGTCCATTTC
TTCGCGCCGGTCAGTCTGTCCCCTGGGTTACACGACCTCCACGACGTCCAGGGCGTCGTG
TTGCCAGGCGGTTCCTCGATGGCCGCCGTCAAGGGACAAATCCGCGTGGCGGAAGATACG
CTTGCCCGCGGACAGCCCACGCTGGGGTTATGCCTGGGAATGCAGAGCATGATGACCGCA
GTCGTGCGCCGACGTCCGGGTTGCGAATCAGCCATTCCCGCCGAAGTGGCTCCGGATGAG
GCTCTGCACAGCTTTGTTCCCTTTGTTGATGGCCGTCATCGCTGCGGCGTATTCCCTTTT
TCCTTCGGGTTGATCCCCGGTGATATCCGCGAAATGCACTACAACCATCGCTACTGCTTT
AACACCGACTTATTACCGGCGCTGGATCGCAGCGGGGTCAGC

rpoB (513 bp)
ATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGCGCAGGCTTCGAAGTTCGAGAC
GTACACCCGACGCACTACGGTCGCGTATGTCCAATCGAAACGCCTGAAGGTCCGAACATC
GGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATACGGTTTCCTTGAGACC
CCGTATCGTAAAGTGACCGACGGTGTGGTTACCGATGAAATTCACTACCTGTCTGCTATC
GAAGAAGGCAACTACGTTATTGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCACTTC
GTAGAAGACCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAG
GTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCG
TTCCTGGAGCACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCG
GTTCCGACTCTGCGCGCTGATAAGCCGCTGGTT

fusA (561 bp)
AACCAGACCATCATCGCCGGTATGGGTGAGCTGCACCTCGACATCATCGTTGACCGTATG
AAGCGTGAATTCAACGTTGAAGCGAACGTCGGTAAACCTCAGGTTGCTTACCGTGAAGCG
ATTCGCGCGAAAGTTACCGATATCGAAGGTAAACACGCCAAGCAGTCTGGTGGTCGTGGT
CAGTACGGTCACGTTGTGATCGACATGTACCCGCTGGAGCCGGGCTCTAACCCGAAAGGT
TACGAGTTCATCAACGACATCAAAGGTGGTGTAATTCCTGGCGAATACATCCCGGCCGTT
GATAAAGGCATCCAGGAACAGCTGAAAGCTGGTCCGCTGGCAGGTTACCCGGTAGTTGAT
ATGGGTATCCGTCTGCACTTCGGTTCTTACCACGACGTTGACTCCTCTGAGCTGGCGTTT
AAACTGGCTGCGTCTATTGCCTTTAAAGAAGGCTTTAAGAAGGCAAAACCAGTTCTGCTT
GAGCCGATCATGAAGGTTGAAGTAGAAACTCCGGAAGAGAACACTGGTGATGTTATCGGT
GACTTGAGCCGTCGTCGCGGT

Sequence comparison:

This page was design for assignation of sequence type (ST) of K. variicola isolates, both for Sanger- and for whole genome-type sequencing technologies. In the case of whole genome sequencing we included, first, the ANI (average nucleotide identity; see references below) analysis for proper identification of bacterial species as: K. variicola, K. pneumoniae, K. quasipneumoniae and K. quasivariicola (this last recently described). Only for K. variicola genomes will be determined the sequence tape (ST). In the other cases determines which of the other species corresponds to those included in the analysis.

This considering the following references:

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.
Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. 2007.
Int J Syst Evol Microbiol 57:81–91. 10.1099/ijs.0.64483-0.

Taxonomic affiliation of new genomes should be verified using average nucleotide identity and multilocus phylogenetic analysis.
Figueras MJ, Beaz-Hidalgo R, Hossain MJ, Liles MR. 2014.
Genome Announc. 4;2. pii: e00927-14. doi: 10.1128/genomeA.00927-14

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :56-62.



Download sequences and ST table:


ST table:

ST Origin Sample ESBL Country Accession Strain leuS pgi pgk phoE pyrG rpoB fusA
1 Human Blood SHV-2 Mexico CDMV00000000 801 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 812 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 811 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 809 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 808 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 807 1 1 1 1 1 1 1
1 Human Blood SHV-2 Mexico 25886267 806 1 1 1 1 1 1 1
1 Human Blood SHV-2a Mexico 25886267 805 1 1 1 1 1 1 1
1 Human Urine Unknown USA QIYN01000001.1 WUSM_KV_09 1 1 1 1 1 1 1
2 Human Sputum Negative Mexico CEGG00000000 8917 1 2 2 1 2 1 2
3 Plant Banana root Negative Mexico CXPC00000000 6A2 1 3 3 2 3 1 3
3 Plant Maize shoots Negative Mexico CXOY00000000 3 1 3 3 2 3 1 3
4 Human Abscess CTX-M-15 Mexico CXOZ00000000 06-268 1 1 4 2 4 2 4
5 Human Blood Negative Mexico CXPB00000000 4880 1 4 5 3 1 1 3
6 Plant Sugar cane stem Negative Mexico CXPA00000000 T29A 2 5 6 4 5 1 5
7 Insect Fungus matrix Negative Panama CP001891.1 At-22 3 1 7 1 6 3 6
8 Plant Maize stems Negative USA CP000964.1 342 1 6 8 5 7 1 7
9 Plant Banana root Negative China CP009274 DX120E 1 6 9 1 8 1 8
10 Human Gut Unknown Denmark CBBA000000000 CAG:634 1 4 10 6 9 1 9
10 Human Blood Unknown China NZ_CP030173.1 13450 1 4 10 6 9 1 9
10 Human Wound swab Unknown Tanzania OVDM01000001.1 KCRI-198C 1 4 10 6 9 1 9
10 Human Sputum Unknown Tanzania OVDP01000001.1 KCRI-201B 1 4 10 6 9 1 9
10 Human Respiratory SHV-30 USA SRX2681986 KPN1264 1 4 10 6 9 1 9
10 Human Urine Unknown USA QIXS01000001.1 WUSM_KV_30 1 4 10 6 9 1 9
10 Human Urine Unknown USA QIXM01000001.1 WUSM_KV_36 1 4 10 6 9 1 9
11 Plant Banana root Unknown China CP010523 DSM15968 4 7 5 1 10 1 2
11 Plant Banana root Negative Mexico 15053318 F2R9 (ATCC BAA-830) 4 7 5 1 10 1 2
12 Human Faeces Negative Brazil JDWA00000000 BZ19 5 8 11 1 11 1 10
13 Insect Nezara viridula Negative USA CP008700.1 KP5-1 6 6 4 7 11 1 2
14 Human Pus Unknown Malaysia JRTV00000000 223/14 7 3 6 8 12 4 2
15 Plant Bitter gourd Unknown Malaysia JSWX00000000 B1 8 4 12 9 1 1 4
16 Plant Chili Unknown Malaysia JSXA00000000 CH4 9 3 12 8 3 5 2
16 Human Urine Unknown USA JMWB00000000 BIDMC61 9 3 12 8 3 5 2
17 Human Respiratory Unknown USA AYJK00000000 MGH20 1 1 1 1 4 1 2
18 missing Urine Unknown USA AYIX00000000 MGH40 10 9 6 1 13 1 11
19 missing Missing Unknown USA AYIF00000000 UCICRE10 1 4 1 1 11 1 2
20 Human Urine Unknown USA JCML00000000 UCI18 1 10 2 10 14 1 2
20 Human Missing Unknown USA LFAP00000000 MGH114 1 10 2 10 14 1 2
20 Human Unknown Unknown Germany UIDW01000001.1 ID_2 1 10 2 10 14 1 2
20 Human Unknown Unknown Germany UIDT01000001.1 ID_5 1 10 2 10 14 1 2
20 Human Unknown Unknown Germany UIDV01000001.1 ID_6 1 10 2 10 14 1 2
20 Human Unknown Unknown Germany UIDM01000001.1 ID_8 1 10 2 10 14 1 2
20 Human Unknown Unknown Germany UIDI01000001.1 ID_11 1 10 2 10 14 1 2
20 Human Urine Unknown USA QIXC01000001.1 WUSM_KV_46 1 10 2 10 14 1 2
21 Human Urine Unknown USA JMZD00000000 MGH68 11 5 5 11 11 1 12
22 Human Urine Unknown USA JMZM00000000 MGH80 11 3 6 12 11 6 2
23 Human Missing Unknown USA LFBA00000000 BIDMC88 1 11 10 6 9 1 9
24 Human Missing Unknown USA LFBC00000000 BIDMC90 12 12 10 1 15 1 13
25 Human Missing Unknown USA LFAD00000000 MGH92 9 13 13 13 7 1 3
26 Human Missing Unknown USA ACXA00000000 1.1.55 9 10 13 13 7 1 14
27 Human Missing Unknown USA ASQN00000000 KTE92 11 6 5 1 16 4 2
28 Human Blood Negative Mexico 15053318 1109 1 1 4 2 17 2 2
29 Human Catheter Negative Mexico 15053318 1171 1 4 3 14 18 1 3
30 Human Secretion Negative Mexico 25886267 9351 1 14 5 1 19 1 2
31 Human Biliary liquids Negative Mexico 25886267 9353 13 15 1 1 20 1 2
32 Human Abscess Negative Mexico 25886267 9925 14 16 14 15 21 7 2
32 Human Blood Negative Mexico 26571390 10239 14 16 14 15 21 7 2
32 Human Sputum Negative USA JVTE01000001 1335_KPNE 14 16 14 15 21 7 2
32 Human Blood Negative USA SRX2682028 KPN700 14 16 14 15 21 7 2
33 Plant Banana stem Negative Mexico 15053318 VI 15 6 6 1 22 1 2
34 Plant Rice roots Negative Mexico 15053318 CFN2006 1 3 5 16 1 8 2
35 Human Vaginal secretion Negative Mexico 29692906 10447 16 1 5 1 1 1 2
36 Human Missing Negative Mexico This work 9271 1 4 15 2 23 9 2
37 Human Missing Negative Mexico This work 9274 17 17 1 1 24 1 2
38 Human Missing Negative Mexico This work 11212 1 4 10 6 1 1 9
39 Human Missing Negative Mexico This work 11214 11 6 13 2 25 3 15
40 Human Missing Negative Mexico This work 11226 1 18 16 17 1 10 2
41 Human Missing Negative Mexico This work 11248 2 5 10 1 1 1 2
42 Human Missing Negative Mexico This work 11254 18 6 4 1 1 6 2
43 Human Missing Negative Mexico This work 11435 17 17 1 1 26 1 16
44 Human Missing Negative Mexico This work 11463 12 19 13 1 27 1 2
45 Human Missing Negative Mexico This work 11436 1 1 6 18 28 1 3
46 Plant Sugarcane rhizosphere soil Negative Mexico This work KvMx3 2 5 17 19 1 1 17
47 Plant Sugarcane root Negative Mexico This work KvMx4 19 15 6 20 22 1 17
48 Plant Maize rhizosphere soil Negative Mexico This work KvMx18 11 10 18 1 4 1 2
49 Human Sputum Unknown USA JVDU01000001.1 521_SSON 1 20 6 21 1 7 2
49 Human Bronchoalveolar Lavage Unknown USA JVDR01000001.1 524_SBOY 1 20 6 21 1 7 2
49 Human Sputum Unknown USA JUYL01000001.1 653_KVAR 1 20 6 21 1 7 2
50 Human Fluid Unknown USA JUXS01000001.1 671_KVAR 1 3 6 22 3 8 2
51 Human Tracheal Aspirate Unknown USA JUTF01000001.1 780_KPNE 1 20 1 23 29 9 5
51 Human Tracheal Aspirate Unknown USA JURI01000001.1 833_KPNE 1 20 1 23 29 9 5
51 Human Tracheal Aspirate Unknown USA JURH01000001.1 834_KPNE 1 20 1 23 29 9 5
51 Human Tracheal Aspirate Unknown USA JURG01000001.1 835_KPNE 1 20 1 23 29 9 5
51 Human Tracheal Aspirate Unknown USA JURF01000001.1 836_KPNE 1 20 1 23 29 9 5
51 Human Tracheal Aspirate Unknown USA JURE01000001.1 837_KPNE 1 20 1 23 29 9 5
51 Human Urine catheter Unknown USA QIYM01000001.1 WUSM_KV_10 1 20 1 23 29 9 5
52 Human Urine, Catheterized Unknown USA JUSW01000001.1 789_KVAR 1 4 3 24 11 1 2
53 Human Body fluid Unknown USA PTGT01000001.1 1565/2503 1 21 1 25 30 11 2
54 Human Unknown Unknown Vietnam ERR025463 1892m 1 5 5 1 1 1 18
55 Human Missing Negative Mexico This work 11446 20 22 19 26 31 12 19
56 Human Unknown Unknown Australia ERS005747 AJ026 21 18 3 2 1 13 2
56 Human Unknown Unknown Australia ERS005771 AJ182 21 18 3 2 1 13 2
56 Human Urine Unknown USA QIYF01000001.1 WUSM_KV_17 21 18 3 2 1 13 2
56 Human Urine Unknown USA QIXD01000001.1 WUSM_KV_45 21 18 3 2 1 13 2
57 Human Unknown Unknown Australia ERS005754 AJ135 22 6 6 27 1 1 14
57 Human Blood Unknown Netherlands JXJH01000001.1 KP-21F 22 6 6 27 1 1 14
58 Human Unknown Unknown Australia ERS005778 AJ292 6 4 1 28 32 14 2
59 missing Missing Negative USA MPCI01000001.1 AR_0016 23 19 5 29 2 1 3
59 Human Urine Unknown USA QIXW01000001.1 WUSM_KV_26 23 19 5 29 2 1 3
60 Human Blood Unknown Bangladesh PJOO01000001.1 BD.DM.165 11 6 5 30 16 4 2
61 Human Missing Unknown USA NGSO01000001.1 BIDMC117 1 9 6 1 13 1 2
61 Human Urine Unknown USA QIXP01000001.1 WUSM_KV_33 1 9 6 1 13 1 2
62 Human Missing Unknown USA NGSP01000001.1 BIDMC118 1 5 5 1 1 1 15
63 Environmental Soil Unknown Singapure CP013985.1 LMG23571 2 5 10 1 1 1 20
64 Plant Roots of tall fescue Negative China LOAR00000000 D5A 10 9 6 1 32 1 2
64 Human Unknown Unknown Germany UIDS01000001.1 ID_24 10 9 6 1 32 1 2
65 Plant Roots Maize Unknown China NZ_CP016344.1 E57-7 9 3 12 31 3 5 2
66 Environmental River water NDM-9 South Korea NZ_CP017284.1 GJ1 1 3 6 8 11 1 2
66 Environmental River water NDM-9 South Korea NZ_CP017849.1 GJ2 1 3 6 8 11 1 2
66 Environmental River water CTX-M-65/NDM-9 South Korea NZ_CP017289.1 GJ3 1 3 6 8 11 1 2
67 Human Unknown Unknown China MOSU00000000 H39 24 3 1 32 33 15 3
68 Human Unknown Unknown Germany UIDY01000001.1 ID_16 13 23 5 33 19 1 2
68 Human Unknown Unknown Germany UIDU01000001.1 ID_18 13 23 5 33 19 1 2
68 Human Unknown Unknown Germany UIEF01000001.1 ID_19 13 23 5 33 19 1 2
69 Human Unknown Unknown Germany UIFG01000001.1 ID_43 13 23 5 34 19 1 2
70 Human Unknown Unknown Germany UIFD01000001.1 ID_49 1 18 6 1 34 13 21
71 Human Blood Unknown China NPGY01000001.1 K2631 25 21 3 35 35 1 22
72 Human Wound swab Unknown Tanzania OVDF01000001.1 KCRI-152E 26 10 1 36 1 13 2
73 Human Catheter Unknown Colombia MSZI01000001.1 KP007 9 4 6 24 1 1 23
74 Human Urine SHV-12 USA SRX2681305 KPN325 19 5 5 6 10 1 22
75 Human Blood SHV-12 USA SRX2680563 KPN458 11 9 6 20 1 13 2
76 Human Urine CTX-M-15 USA SRX2681541 KPN807 27 4 3 1 35 1 24
77 Human Respiratory KPC-2 USA SRX2681803 KPN1401 1 1 20 1 1 11 25
77 Human Respiratory KPC-2 USA SRX2681790 KPN1415 1 1 20 1 1 11 25
78 Human Urine CTX-M-15/NDM-1 USA SRX2681713 KPN1481 28 24 5 37 36 1 4
79 Human Wound SHV-12 USA SRX2681646 KPN1556 11 1 3 1 11 1 2
79 Human Urine Unknown USA QIWX01000001.1 WUSM_KV_51 11 1 3 1 11 1 2
80 Human Urine SHV-12, SHV-66 USA SRX2681570 KPN1751 1 6 10 3 37 1 2
81 Human Urine Unknown India LZGB01000001.1 KV093 15 6 1 1 38 14 26
82 Plant/Fungi Mycorrhiza of Pisolithus tinctorius Unknown China LQMR01000001.1 KV321 29 4 6 1 1 14 15
83 Human Catheter Negative Mexico This work 9635 2 6 12 38 39 16 4
84 Plant Root of a sugarcane plant Negative Mexico FLLH01000001 KvMx2 30 25 21 39 40 17 27
85 Human Faeces Unknown China NLDD01000001 L18 31 24 22 40 41 1 28
86 Environmental Industrial effluent Unknown Pakistan MSCS01000001 MB351 11 26 2 41 1 1 2
87 Animal Bovine Unknown Canada LFYK01000000 NL58 1 10 14 42 2 13 2
87 Animal Bovine Unknown Canada LGAW01000000 NL49 1 10 14 42 2 13 2
88 Animal Bovine - Intestinal Unknown USA ERS011908 QMP_B2-288 11 27 5 41 1 1 2
89 Animal Bovine - Intestinal Unknown USA ERS011920 QMP_B2-340 13 28 3 9 1 1 2
89 Animal Bovine - Intestinal Unknown USA ERS011926 QMP_B2-483 13 28 3 9 1 1 2
90 Animal Bovine - Intestinal Unknown USA ERS011925 QMP_B2-481 2 1 3 38 4 18 13
91 Animal Bovine - Intestinal Unknown USA ERS011933 QMP_M1-043 1 17 1 25 42 1 2
92 Animal Unknown Unknown USA ERS011961 QMP_M1-428 32 29 3 24 35 19 4
93 Animal Urine Unknown USA ERS011977 QMP_M1-893 33 6 1 11 43 1 29
94 Human Missing Unknown China PWAV01000001.1 SCKV020062 1 6 23 43 1 1 2
94 Human Missing Unknown China PWAU01000001.1 SCKV020067 1 6 23 43 1 1 2
94 Human Missing Unknown China PWAT01000001.1 SCKV020069 1 6 23 43 1 1 2
94 Human Unknown Unknown China NZ_CP028555.1 WCHKP19 1 6 23 43 1 1 2
95 Human Missing Unknown China NWEW01000001.1 SCKV020148 1 3 3 2 3 20 3
96 Human Missing Unknown South Africa NXJG01000001.1 ST-1791-KOO1 34 6 6 1 35 1 30
97 Environmental GM-anode biofilm Unknown Missing DBMQ01000001.1 UBA694 18 24 5 1 1 1 2
98 Environmental Metal Unknown USA DFCX01000001.1 UBA3043 11 30 6 1 35 1 30
99 Environmental Metal/Plastic Unknown USA DFSA01000001.1 UBA3449 11 4 10 6 44 8 31
100 Environmental Metal/Plastic Unknown USA DGAC01000001.1 UBA4040 13 24 6 30 1 1 2
101 Human Unknown Unknown China NZ_CP027064.2 WCHKV030666 28 31 5 37 1 1 2
102 Human Unknown Unknown China NWEJ01000001.1 WCHKV030937 35 4 6 1 1 1 9
103 Human Urine Unknown USA QIYV01000001.1 WUSM_KV_01 6 24 5 1 1 1 28
104 Human Unknown Unknown USA QIYU01000001.1 WUSM_KV_02 2 5 6 3 5 1 5
105 Human Aspirate, left breast Unknown USA QIYT01000001.1 WUSM_KV_03 23 19 2 8 45 1 2
106 Human Tracheal Aspirate Unknown USA QIYS01000001.1 WUSM_KV_04 21 18 3 2 1 13 32
107 Human Sputum Unknown USA QIYQ01000001.1 WUSM_KV_06 36 6 10 3 37 1 2
107 Human Urine Unknown USA QIXK01000001.1 WUSM_KV_38 36 6 10 3 37 1 2
107 Human Wound Unknown USA QIWZ01000001.1 WUSM_KV_49 36 6 10 3 37 1 2
108 Human Urine Unknown USA QIYP01000001.1 WUSM_KV_07 2 27 6 2 1 13 15
109 Human Drainage, left groin Unknown USA QIYO01000001.1 WUSM_KV_08 2 6 1 25 32 11 1
109 Human Tibia Unknown USA QIYL01000001.1 WUSM_KV_11 2 6 1 25 32 11 1
110 Human Urine Unknown USA QIYK01000001.1 WUSM_KV_12 5 32 5 44 46 13 2
111 Human Urine Unknown USA QIYJ01000001.1 WUSM_KV_13 37 33 1 3 37 7 33
112 Human Blood Unknown USA QIYI01000001.1 WUSM_KV_14 38 34 24 45 47 1 2
112 Human Urine Unknown USA QIYD01000001.1 WUSM_KV_19 38 34 24 45 47 1 2
113 Human Wound, drain right lower quadrant Unknown USA QIYH01000001.1 WUSM_KV_15 17 17 1 1 24 1 16
114 Human Blood Unknown USA QIYG01000001.1 WUSM_KV_16 39 1 1 1 1 1 1
115 Human Urine Unknown USA QIYE01000001.1 WUSM_KV_18 11 1 6 46 48 2 2
116 Human Urine Unknown USA QIYB01000001.1 WUSM_KV_21 40 27 6 3 1 13 15
117 Human Urine Unknown USA QIYA01000001.1 WUSM_KV_22 41 5 6 8 4 2 2
117 Human Urine Unknown USA QIXZ01000001.1 WUSM_KV_23 41 5 6 8 4 2 2
117 Human Blood Unknown USA QIXY01000001.1 WUSM_KV_24 41 5 6 8 4 2 2
118 Human Blood Unknown USA QIXX01000001.1 WUSM_KV_25 14 1 6 1 36 1 15
118 Human Urine Unknown USA QIXN01000001.1 WUSM_KV_35 14 1 6 1 36 1 15
119 Human Urine Unknown USA QIXV01000001.1 WUSM_KV_27 1 28 6 43 49 13 2
120 Human Urine Unknown USA QIXU01000001.1 WUSM_KV_28 11 23 6 1 35 1 3
121 Human Urine Unknown USA QIXT01000001.1 WUSM_KV_29 2 4 6 24 4 21 2
121 Human Urine Unknown USA QIXQ01000001.1 WUSM_KV_32 2 4 6 24 4 21 2
122 Human Urine Unknown USA QIXR01000001.1 WUSM_KV_31 42 1 3 47 1 7 30
123 Human Urine Unknown USA QIXL01000001.1 WUSM_KV_37 41 5 6 8 35 2 34
124 Human Urine Unknown USA QIXJ01000001.1 WUSM_KV_39 1 18 12 1 34 13 21
125 Human Urine Unknown USA QIXH01000001.1 WUSM_KV_41 35 27 6 3 1 13 15
126 Human Urine Unknown USA QIXE01000001.1 WUSM_KV_44 38 35 1 1 35 1 2
127 Human Urine Unknown USA QIXA01000001.1 WUSM_KV_48 11 9 6 20 1 13 35
128 Human Bronch wash Unknown USA QIWY01000001.1 WUSM_KV_50 5 8 7 40 11 11 10
129 Human Urine Unknown USA QIWW01000001.1 WUSM_KV_52 1 3 12 1 1 10 2
130 Human Urine Unknown USA QIWV01000001.1 WUSM_KV_53 9 4 5 1 32 13 2
131 Human Blood Unknown USA QIWU01000001.1 WUSM_KV_54 43 1 3 38 4 1 4
132 Human BAL Unknown USA QIWT01000001.1 WUSM_KV_55 1 19 1 38 1 1 36
133 Human UR CVS Unknown USA QIVS01000001.1 WUSM_KV_82 1 10 6 45 22 7 2
134 Human Blood Unknown USA QIVD01000001.1 WUSM_KV_97 1 36 1 48 35 1 37
135 Human Blood Unknown USA QIUP01000001.1 WUSM_KV_111 13 6 6 41 50 2 2
136 Human Missing Unknown USA PGIO01000001.1 YD626-2 1 4 5 6 9 1 9
60 Human Blood CTX-M-15 Bangladesh QUAA01000001 BD_DM_32 11 6 5 30 16 4 2
60 Human Blood CTX-M-15 Bangladesh QTZQ01000001.1 BD_DM_33 11 6 5 30 16 4 2
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZR01000001.1 BD_DM_97 11 6 5 30 16 4 2
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZS01000001.1 BD_DM_115 11 6 5 30 16 4 2
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZT01000001.1 BD_DM_166 11 6 5 30 16 4 2
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZU01000001.1 BD_DM_167 11 6 5 30 16 4 2
60 Human Blood CTX-M-15 Bangladesh QTZV01000001.1 BD_DM_169 11 6 5 30 16 4 2
60 Human Blood CTX-M-15 Bangladesh QTZW01000001.1 BD_DM_322 11 6 5 30 16 4 2
60 Human Blood CTX-M-15 Bangladesh QTZX01000001.1 BD_DM_323 11 6 5 30 16 4 2
60 Human Blood CTX-M-15 Bangladesh QTZY01000001.1 BD_DM_395 11 6 5 30 16 4 2


Who is Klebsiella variicola?

K. variicola is a Gram-negative, facultative anaerobic, non-spore-forming, non-motile rod. Its form is circular, convex and smooth colonies and grows around 11-41ºC. K. variicola was initially identified as endophyte in plants and pathogen in humans. However, according to different reports it could be considered ubiquitous in nature. According to its description in the literature, K. variicola can be found in soil, water, plants, insects, humans and animals. In all of them K. variicola plays different roles as; endophyte in plants, as pathogen in humans and animals and symbiont in insects.

Recent publication about K. variicola:

Klebsiella variicola an emerging pathogen in humans.
Rodríguez-Medina Nadia, Barrios-Camacho Humberto, Duran-Bedolla Josefina, Garza-Ramos Ulises. Emerging Microbes and Infection. 2019. Under Review.

Phenotypic and molecular characterization of Klebsiella spp. isolates causing community-acquired infections.
Garza-Ramos U, Barrios-Camacho H, Moreno-Domínguez S, Toribio-Jiménez J, Jardón-Pineda D, Cuevas-Peña J, Sánchez-Pérez A, Duran-Bedolla J, Olguín-Rodriguez J, Román-Román A. New Microbes New Infect. 2018 Feb 17;23:17-27. Download

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :29-40. Download

Klebsiella variicola and Klebsiella quasipneumoniae genomic analysis provides insights into their capacity to adapt to clinical and plant settings.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jeiry Toribio-Jimenez, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :56-62. Download

Hypervirulence and hypermucoviscosity: Two different but complementary Klebsiella spp. phenotypes?
Catalán-Nájera JC, Garza-Ramos U, Barrios-Camacho H. Virulence. 2017. Oct 3;8(7):1111-1123. Download

Identification and Characterization of Imipenem-Resistant Klebsiella pneumoniae and Susceptible Klebsiella variicola Isolates Obtained from the Same Patient.
Garza-Ramos U*, Moreno-Dominguez S, Hernández-Castro R, Silva-Sanchez J, Barrios H, Reyna-Flores F, Sanchez-Perez A, Carrillo-Casas EM, Sanchez-León MC, Moncada-Barron D.. Microb Drug Resist. 2016 Apr;22(3):179-84. Download

Draft genome sequences of the Klebsiella variicola plant isolates.
Martinez-Romero Esperanza, Jesús Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesús Martínez-Barnetche, Juan Téllez-Sosa, Rosa Elena Gómez-Barreto, Ulises Garza-Ramos. Genome Announc. 2015 Sep 10;3(5). Download

Draft genome sequence of the first hypermucoviscous Klebsiella variicola clinical isolate.
Ulises Garza-Ramos; Jesus Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesus Martínez-Barnetche, Veronica Andrade. Genome Announc. 2015 Apr 9;3(2). Download

Development of a multiplex-PCR probe system for proper identification of Klebsiella variicola.
Ulises Garza-Ramos, Jesús Silva-Sánchez, Esperanza Martínez-Romero, Perla Tinoco, Marisol Pina-Gonzales, Humberto Barrios, Jesús Martínez-Barnetche, Rosa elena Gomez-Barreto, Juan Tellez. BMC Microbiol. 2015 Dec;15(1):396. Download


SUBMISSIONS

In order to function as such a resource and to maintain the quality of the data, the databases are hand curated, and all entries will be checked before final entry into the main database.

To submit your data please contact the curator directly.

email: ulises.garza @insp.mx
INSTITUTO NACIONAL DE SALUD PÚBLICA, MÉXICO - DERECHOS RESERVADOS © 2019
Av. Universidad No. 655 Colonia Santa María Ahuacatitlán, Cerrada Los Pinos y Caminera C.P. 62100, Cuernavaca, Morelos. México. Tel. (777) 329 3000
Contact: webmaster_kv@ insp.mx