Allelic profile:

leuS pgi pgk phoE pyrG rpoB fusA



Which ST profile has your sequence?, Select your fasta file:


Run average nucleotide identity (ANI)



Enter Query Sequence:





Database developed by the Centro de Investigación Sobre Enfermedades Infecciosas (CISEI) in collaboration with the Centro de Ciencias Genómicas (CCG-UNAM). This site has been funded by the Instituto Nacional de Salud Pública (INSP).

Reference for citations of MLST of K. variicola:

Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises. Scientific Reports. 2019. Molecular epidemiology of Klebsiella variicola obtained from different sources.


Reference for citations of MLST of K. variicola:

Molecular epidemiology of Klebsiella variicola obtained from different sources.
Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Rodriguez-Medina Nadia, Lozano Aguirre Luis, Perez-Carrascal Olga Maria, Rojas Jesús, and Garza-Ramos Ulises.
Scientific Reports. 2019.

Protocol used for MLST of Klebsiella variicola.

Genes of MLST:
leuS(Leucyl-tRNA synthethase)
pgi(Phosphoglucose iomerase)
pgk(Phosphoglycerate kinase)
phoE(Phosphoporine E)
pyrG(CTP synthase)
rpoB(β-subunit of RNA polymerase B)
fusA(Elongation factor G)

PCR Amplification:
Gene/primerSequence (5’-3’)Annealing (Tm)Amplification Product
leuSKv-FCGAACAGGTTATCGACGGCT63 °C968 bp
leuSKv-RCAAAGGTGTCGGTTTCACGC
pgiKv-FAAAGAGACCGATCTGGCAGG60 °C760 bp
pgiKv-RACCAGATACCGATCAGCGCC
pgkKv-FTCGTGATGGATGCTTTCGGT63 °C663 bp
pgkKv-RAGATTTTGTCAGCGATGCCG
phoEKv-FCTGTACGACGTGGAAGCCTG63 °C613 bp
phoEKv-RCCACGAAGGCGTTCATGTTT
pyrGKv-FCCGATCGCTATGGTCGCTG60 °C664 bp
pyrGKv-RCGGGACATCAGTTCCGGGT
rpoBKv-FGCCAGCTGTCCCAGTTTATG60 °C648 bp
rpoBKv-RGAACGGTACCGCCACGTTTA
fusAKv-FGGGGCTGCTTTATACCTCGG60 °C782 bp
fusAKv-RTGATAGTCATCGTCACGCCG

Conditions of amplification:

PCR: 3 min at 96°C; 30 cycles of 1 min at 95°C; 30 seg annealing temperature (60°C or 63°C according of amplification gene); 1 min at 72°C. Following 7 min at 72°C.

PCR reaction:
Each reaction contains 10ng of chromosomal DNA, 12.5 pmol of each primer, 25mM of the dNPTs, 1X of PCR Buffer, 1 unit of Taq polymerase and water to 50 ml.

Sequencing of PCR products:
The primer used by PCR amplification were used by Sanger sequencing step

Allele template. Allelic profile of K. variicola 801 (GenBank: CDMV01000001):
leuS (594 bp)
GATCACTGGCCAGACACCGTAAAGACCATGCAGCGCAACTGGATCGGCCGTTCCGAAGGG
GTGGAAATCTCCTTTGACGTCAACAACTACGCCGATAAGCTGACCGTCTACACCACCCGT
CCGGACACCTTTATGGGCTGCACCTACCTGGCTGTCGCGGCGGGTCACCCGCTGGCGCAG
CAGGCTGCAGCGAACAATCCGGCGCTGGCTGCCTTTATCGACGAATGCCGTAATACCAAA
GTAGCCGAAGCCGACATGGCGACGATGGAGAAAAAAGGCGTCGATACCGGGTTTAAAGCC
ATTCACCCGCTGACCGGCGAAGAAATTCCTGTCTGGGCGGCAAACTTCGTGCTGATGGAA
TATGGCACCGGCGCGGTCATGGCCGTTCCGGGTCACGACCAGCGTGACTATGAGTTCGCC
AGCAAGTACGGTCTGAACATCAAGCCGGTTATCCTCGCCGCTGACGGCAGCGAGCCGGAT
CTCTCCGCGCAGGCGCTGACCGAGAAAGGCGTCCTGTTTAACTCCGGCGAGTTCAGCGGC
CTCGATTATGAAGCCGGCTTCAACGCCATTGCCGACAAACTGGCAGCCATGGGC

pgi (600 bp)
GACCGTGCGGTACTGCACGTCGCGCTGCGCAACCGCAGCAATACGCCGATTGTGGTTGAT
GGCAAAGATGTGATGCCGGAAGTGAACGCTGTGCTGGAGAAGATGAAAACCTTCTCAGAA
GCGATTATCTCCGGTAGCTGGAAAGGCTATACCGGCAAACCGATCACCGACGTGGTTAAC
ATTGGTATCGGCGGTTCCGACCTCGGTCCGTTCATGGTCACCGAAGCGCTGCGTCCGTAC
AAAAACCACCTCAACATGCACTTTGTCTCCAACGTCGATGGCACCCACATCGCTGAAGTG
CTGAAGAACGTCAACCCGGAAACGACCCTGTTCCTGGTGGCGTCCAAGACCTTCACCACT
CAGGAAACCATGACCAACGCCCACAGCGCGCGCGACTGGTTCCTGGCGACCGCGGGCGAC
GACAAACACGTGGCCAAACACTTCGCGGCGCTTTCTACCAACGCGAAAGCGGTTGGCGAG
TTCGGCATCGACACCGCCAACATGTTTGAATTCTGGGACTGGGTTGGCGGCCGTTACTCC
CTGTGGTCGGCGATTGGCCTGTCCATCATTCTCTCCGTGGGCTTCGACAACTTCGTTGAG

pgk (444 bp)
GCGTGCGCAGGCCCGCTGCTGGCCGCTGAACTGGACGCGCTGGGTAAAGCGCTGAAAGAG
CCGGCTCGTCCGATGGTCGCTATCGTGGGTGGTTCTAAAGTGTCCACCAAACTGACCGTG
CTGGATTCCCTGTCTAAAATCGCTGACCAGCTGATCGTCGGCGGCGGTATCGCCAACACC
TTCGTTGCTGCCCAGGGCCACAACGTCGGTAAATCCCTGTACGAAGCAGACCTGGTTGAT
GAAGCTAAGCGCCTGCTGAGCACCTGTGATATCCCGGTTCCGACGGACGTTCGCGTCGCG
ACCGAGTTCTCCGAAACCGCAACGGCAACCCTGAAATCTGTTAACGACATCAAAGATGAC
GAGCAGATTCTGGACCTTGGCGACGTTTCCGCACAGAAACTGGCCGACATCCTGAAAAAC
GCCAAAACCATCCTGTGGAACGGC

phoE (453 bp)
GATTCCTCTGCCCAGACCGATAACTTTATGACCAAACGCGCCAGCGGCCTGGCGACCTAC
CGCAATACCGATTTCTTCGGTCTGGTGGATGGTCTGGATATGACCCTGCAGTACCAGGGT
AAAAACGAAGGCCGTGAAGCGAAGAAACAGAACGGCGACGGCGTTGGCACCTCATTAAGC
TATGATTTCGGCGGCAGCGACTTCGCCGTCAGCGCGGCCTACACCAGCTCCGACCGTACC
AACGATCAGAACCTGCTGGCCCGCGGCCAGGGTTCGAAAGCGGAAGCCTGGGCGACCGGC
CTGAAATATGACGCCAACAATATCTACCTGGCGACCATGTATTCTGAGACCCGCAAAATG
ACCCCGATCAGCGGCGGTTTTGCCAACAAAGCGCAGAACTTTGAAGCGGTGGCGCAGTAT
CAGTTCGACTTCGGTCTGCGTCCGTCCCTCGGC

pyrG (522 bp)
ACGTCCTTGCGCATCGCACTGATTGGCCGTGAGTCAGACCACCGTCTGGTCTACCCCGCC
ACGCTTGGCTCACTGGGTGATGCCGCGGCGTCGCTGGGGCTGAACCTGGAGGTCCATTTC
TTCGCGCCGGTCAGTCTGTCCCCTGGGTTACACGACCTCCACGACGTCCAGGGCGTCGTG
TTGCCAGGCGGTTCCTCGATGGCCGCCGTCAAGGGACAAATCCGCGTGGCGGAAGATACG
CTTGCCCGCGGACAGCCCACGCTGGGGTTATGCCTGGGAATGCAGAGCATGATGACCGCA
GTCGTGCGCCGACGTCCGGGTTGCGAATCAGCCATTCCCGCCGAAGTGGCTCCGGATGAG
GCTCTGCACAGCTTTGTTCCCTTTGTTGATGGCCGTCATCGCTGCGGCGTATTCCCTTTT
TCCTTCGGGTTGATCCCCGGTGATATCCGCGAAATGCACTACAACCATCGCTACTGCTTT
AACACCGACTTATTACCGGCGCTGGATCGCAGCGGGGTCAGC

rpoB (513 bp)
ATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGCGCAGGCTTCGAAGTTCGAGAC
GTACACCCGACGCACTACGGTCGCGTATGTCCAATCGAAACGCCTGAAGGTCCGAACATC
GGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATACGGTTTCCTTGAGACC
CCGTATCGTAAAGTGACCGACGGTGTGGTTACCGATGAAATTCACTACCTGTCTGCTATC
GAAGAAGGCAACTACGTTATTGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCACTTC
GTAGAAGACCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAG
GTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCG
TTCCTGGAGCACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCG
GTTCCGACTCTGCGCGCTGATAAGCCGCTGGTT

fusA (561 bp)
AACCAGACCATCATCGCCGGTATGGGTGAGCTGCACCTCGACATCATCGTTGACCGTATG
AAGCGTGAATTCAACGTTGAAGCGAACGTCGGTAAACCTCAGGTTGCTTACCGTGAAGCG
ATTCGCGCGAAAGTTACCGATATCGAAGGTAAACACGCCAAGCAGTCTGGTGGTCGTGGT
CAGTACGGTCACGTTGTGATCGACATGTACCCGCTGGAGCCGGGCTCTAACCCGAAAGGT
TACGAGTTCATCAACGACATCAAAGGTGGTGTAATTCCTGGCGAATACATCCCGGCCGTT
GATAAAGGCATCCAGGAACAGCTGAAAGCTGGTCCGCTGGCAGGTTACCCGGTAGTTGAT
ATGGGTATCCGTCTGCACTTCGGTTCTTACCACGACGTTGACTCCTCTGAGCTGGCGTTT
AAACTGGCTGCGTCTATTGCCTTTAAAGAAGGCTTTAAGAAGGCAAAACCAGTTCTGCTT
GAGCCGATCATGAAGGTTGAAGTAGAAACTCCGGAAGAGAACACTGGTGATGTTATCGGT
GACTTGAGCCGTCGTCGCGGT

Sequence comparison:

This page was design for assignation of sequence type (ST) of K. variicola isolates, both for Sanger- and for whole genome-type sequencing technologies. In the case of whole genome sequencing we included, first, the ANI (average nucleotide identity; see references below) analysis for proper identification of bacterial species as: K. variicola, K. pneumoniae, K. quasipneumoniae and K. quasivariicola (this last recently described). Only for K. variicola genomes will be determined the sequence tape (ST). In the other cases determines which of the other species corresponds to those included in the analysis.

This considering the following references:

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.
Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. 2007.
Int J Syst Evol Microbiol 57:81–91. 10.1099/ijs.0.64483-0.

Taxonomic affiliation of new genomes should be verified using average nucleotide identity and multilocus phylogenetic analysis.
Figueras MJ, Beaz-Hidalgo R, Hossain MJ, Liles MR. 2014.
Genome Announc. 4;2. pii: e00927-14. doi: 10.1128/genomeA.00927-14

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :56-62.



Download sequences and ST table:


ST table:

[1 '1' datetime.date(2019, 6, 12) None None None None 'Mexico' None 'Human' 'CDMV00000000' '801' 'Blood' None 'SHV-2' 'Leus object (1)' 'Pgi object (1)' 'Pgk object (1)' 'Phoe object (1)' 'Pyrg object (1)' 'Rpob object (1)' 'Tonb object (1)' 'Sender object (1)' 'Curator object (1)']
ST Origin Sample ESBL Country Accession Strain leuS pgi pgk phoE pyrG rpoB fusA
1 Human Blood SHV-2 Mexico CDMV00000000 801 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)


Who is Klebsiella variicola?

K. variicola is a Gram-negative, facultative anaerobic, non-spore-forming, non-motile rod. Its form is circular, convex and smooth colonies and grows around 11-41ºC. K. variicola was initially identified as endophyte in plants and pathogen in humans. However, according to different reports it could be considered ubiquitous in nature. According to its description in the literature, K. variicola can be found in soil, water, plants, insects, humans and animals. In all of them K. variicola plays different roles as; endophyte in plants, as pathogen in humans and animals and symbiont in insects.

Recent publication about K. variicola:

Klebsiella variicola an emerging pathogen in humans.
Rodríguez-Medina Nadia, Barrios-Camacho Humberto, Duran-Bedolla Josefina, Garza-Ramos Ulises. Emerging Microbes and Infection. 2019. Under Review.

Phenotypic and molecular characterization of Klebsiella spp. isolates causing community-acquired infections.
Garza-Ramos U, Barrios-Camacho H, Moreno-Domínguez S, Toribio-Jiménez J, Jardón-Pineda D, Cuevas-Peña J, Sánchez-Pérez A, Duran-Bedolla J, Olguín-Rodriguez J, Román-Román A. New Microbes New Infect. 2018 Feb 17;23:17-27. Download

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :29-40. Download

Klebsiella variicola and Klebsiella quasipneumoniae genomic analysis provides insights into their capacity to adapt to clinical and plant settings.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jeiry Toribio-Jimenez, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :56-62. Download

Hypervirulence and hypermucoviscosity: Two different but complementary Klebsiella spp. phenotypes?
Catalán-Nájera JC, Garza-Ramos U, Barrios-Camacho H. Virulence. 2017. Oct 3;8(7):1111-1123. Download

Identification and Characterization of Imipenem-Resistant Klebsiella pneumoniae and Susceptible Klebsiella variicola Isolates Obtained from the Same Patient.
Garza-Ramos U*, Moreno-Dominguez S, Hernández-Castro R, Silva-Sanchez J, Barrios H, Reyna-Flores F, Sanchez-Perez A, Carrillo-Casas EM, Sanchez-León MC, Moncada-Barron D.. Microb Drug Resist. 2016 Apr;22(3):179-84. Download

Draft genome sequences of the Klebsiella variicola plant isolates.
Martinez-Romero Esperanza, Jesús Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesús Martínez-Barnetche, Juan Téllez-Sosa, Rosa Elena Gómez-Barreto, Ulises Garza-Ramos. Genome Announc. 2015 Sep 10;3(5). Download

Draft genome sequence of the first hypermucoviscous Klebsiella variicola clinical isolate.
Ulises Garza-Ramos; Jesus Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesus Martínez-Barnetche, Veronica Andrade. Genome Announc. 2015 Apr 9;3(2). Download

Development of a multiplex-PCR probe system for proper identification of Klebsiella variicola.
Ulises Garza-Ramos, Jesús Silva-Sánchez, Esperanza Martínez-Romero, Perla Tinoco, Marisol Pina-Gonzales, Humberto Barrios, Jesús Martínez-Barnetche, Rosa elena Gomez-Barreto, Juan Tellez. BMC Microbiol. 2015 Dec;15(1):396. Download


SUBMISSIONS

In order to function as such a resource and to maintain the quality of the data, the databases are hand curated, and all entries will be checked before final entry into the main database.

To submit your data please contact the curator directly.

email: ulises.garza @insp.mx
INSTITUTO NACIONAL DE SALUD PÚBLICA, MÉXICO - DERECHOS RESERVADOS © 2019
Av. Universidad No. 655 Colonia Santa María Ahuacatitlán, Cerrada Los Pinos y Caminera C.P. 62100, Cuernavaca, Morelos. México. Tel. (777) 329 3000
Contact: webmaster_kv@ insp.mx