Allelic profile:

leuS pgi pgk phoE pyrG rpoB tonB



Which ST profile has your sequence?, Select your fasta file:


Run average nucleotide identity (ANI)



Enter Query Sequence:





Database developed by the Centro de Investigación Sobre Enfermedades Infecciosas (CISEI) in collaboration with the Centro de Ciencias Genómicas (CCG-UNAM). This site has been funded by the Instituto Nacional de Salud Pública (INSP).

Reference for citations of MLST of K. variicola:

Barrios-Camacho Humberto, Aguilar Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Lozano Luis, Perez-Carrascal Olga Maria, Rojas Jesús, Garza-Ramos Ulises (2017). Development of Multilocus Sequence Typing (MLST) scheme for the characterization of Klebsiella variicola isolates.


Reference for citations of MLST of K. variicola:

Development of Multilocus Sequence Typing (MLST) scheme for the characterization of Klebsiella variicola isolates. Barrios-Camacho Humberto, Aguilar-Vera Alejandro, Beltran-Rojel Marilu, Aguilar-Vera Edgar, Duran-Bedolla Josefina, Lozano Luis, Perez-Carrascal Olga Maria, Rojas Jesús, Garza-Ramos Ulises (2017).

Protocol used for MLST of Klebsiella variicola.

Genes of MLST:
leuS(Leucyl-tRNA synthethase)
pgi(Phosphoglucose iomerase)
pgk(Phosphoglycerate kinase)
phoE(Phosphoporine E)
pyrG(CTP synthase)
rpoB(β-subunit of RNA polymerase B)
tonB(Periplasmic energy traducer)

PCR Amplification:
Gene/primerSequence (5’-3’)Annealing (Tm)Product
leuSKv-FCGAACAGGTTATCGACGGCT63 °C594 pb
leuSKv-RCAAAGGTGTCGGTTTCACGC
pgiKv-FAAAGAGACCGATCTGGCAGG60 °C600 bp
pgiKv-RACCAGATACCGATCAGCGCC
pgkKv-FTCGTGATGGATGCTTTCGGT63 °C444 pb
pgkKv-RAGATTTTGTCAGCGATGCCG
phoEKv-FCTGTACGACGTGGAAGCCTG63 °C453 pb
phoEKv-RCCACGAAGGCGTTCATGTTT
pyrGKv-FCCGATCGCTATGGTCGCTG60 °C522 pb
pyrGKv-RCGGGACATCAGTTCCGGGT
rpoBKv-FGCCAGCTGTCCCAGTTTATG60 °C513 bp
rpoBKv-RGAACGGTACCGCCACGTTTA
tonBKv-FGGGGCTGCTTTATACCTCGG60 °C450 bp
tonBKv-RTGATAGTCATCGTCACGCCG

Conditions of amplification:

PCR: 3 min at 96°C; 30 cycles of 1 min at 95°C; 30 seg annealing temperature (60°C or 63°C according of amplification gene); 1 min at 72°C. Following 7 min at 72°C.

PCR reaction:
Each reaction contains 10ng of chromosomal DNA, 12.5 pmol of each primer, 25mM of the dNPTs, 1X of PCR Buffer, 1 unit of Taq polymerase and water to 50 ml.

Sequencing of PCR products:
The primer used by PCR amplification were used by Sanger sequencing step

Allele template. Allelic profile of K. variicola 801 (GenBank: CDMV01000001):
leuS (594 bp)
GATCACTGGCCAGACACCGTAAAGACCATGCAGCGCAACTGGATCGGCCGTTCCGAAGGG
GTGGAAATCTCCTTTGACGTCAACAACTACGCCGATAAGCTGACCGTCTACACCACCCGT
CCGGACACCTTTATGGGCTGCACCTACCTGGCTGTCGCGGCGGGTCACCCGCTGGCGCAG
CAGGCTGCAGCGAACAATCCGGCGCTGGCTGCCTTTATCGACGAATGCCGTAATACCAAA
GTAGCCGAAGCCGACATGGCGACGATGGAGAAAAAAGGCGTCGATACCGGGTTTAAAGCC
ATTCACCCGCTGACCGGCGAAGAAATTCCTGTCTGGGCGGCAAACTTCGTGCTGATGGAA
TATGGCACCGGCGCGGTCATGGCCGTTCCGGGTCACGACCAGCGTGACTATGAGTTCGCC
AGCAAGTACGGTCTGAACATCAAGCCGGTTATCCTCGCCGCTGACGGCAGCGAGCCGGAT
CTCTCCGCGCAGGCGCTGACCGAGAAAGGCGTCCTGTTTAACTCCGGCGAGTTCAGCGGC
CTCGATTATGAAGCCGGCTTCAACGCCATTGCCGACAAACTGGCAGCCATGGGC

pgi (600 bp)
GACCGTGCGGTACTGCACGTCGCGCTGCGCAACCGCAGCAATACGCCGATTGTGGTTGAT
GGCAAAGATGTGATGCCGGAAGTGAACGCTGTGCTGGAGAAGATGAAAACCTTCTCAGAA
GCGATTATCTCCGGTAGCTGGAAAGGCTATACCGGCAAACCGATCACCGACGTGGTTAAC
ATTGGTATCGGCGGTTCCGACCTCGGTCCGTTCATGGTCACCGAAGCGCTGCGTCCGTAC
AAAAACCACCTCAACATGCACTTTGTCTCCAACGTCGATGGCACCCACATCGCTGAAGTG
CTGAAGAACGTCAACCCGGAAACGACCCTGTTCCTGGTGGCGTCCAAGACCTTCACCACT
CAGGAAACCATGACCAACGCCCACAGCGCGCGCGACTGGTTCCTGGCGACCGCGGGCGAC
GACAAACACGTGGCCAAACACTTCGCGGCGCTTTCTACCAACGCGAAAGCGGTTGGCGAG
TTCGGCATCGACACCGCCAACATGTTTGAATTCTGGGACTGGGTTGGCGGCCGTTACTCC
CTGTGGTCGGCGATTGGCCTGTCCATCATTCTCTCCGTGGGCTTCGACAACTTCGTTGAG

pgk (444 bp)
GCGTGCGCAGGCCCGCTGCTGGCCGCTGAACTGGACGCGCTGGGTAAAGCGCTGAAAGAG
CCGGCTCGTCCGATGGTCGCTATCGTGGGTGGTTCTAAAGTGTCCACCAAACTGACCGTG
CTGGATTCCCTGTCTAAAATCGCTGACCAGCTGATCGTCGGCGGCGGTATCGCCAACACC
TTCGTTGCTGCCCAGGGCCACAACGTCGGTAAATCCCTGTACGAAGCAGACCTGGTTGAT
GAAGCTAAGCGCCTGCTGAGCACCTGTGATATCCCGGTTCCGACGGACGTTCGCGTCGCG
ACCGAGTTCTCCGAAACCGCAACGGCAACCCTGAAATCTGTTAACGACATCAAAGATGAC
GAGCAGATTCTGGACCTTGGCGACGTTTCCGCACAGAAACTGGCCGACATCCTGAAAAAC
GCCAAAACCATCCTGTGGAACGGC

phoE (453 bp)
GATTCCTCTGCCCAGACCGATAACTTTATGACCAAACGCGCCAGCGGCCTGGCGACCTAC
CGCAATACCGATTTCTTCGGTCTGGTGGATGGTCTGGATATGACCCTGCAGTACCAGGGT
AAAAACGAAGGCCGTGAAGCGAAGAAACAGAACGGCGACGGCGTTGGCACCTCATTAAGC
TATGATTTCGGCGGCAGCGACTTCGCCGTCAGCGCGGCCTACACCAGCTCCGACCGTACC
AACGATCAGAACCTGCTGGCCCGCGGCCAGGGTTCGAAAGCGGAAGCCTGGGCGACCGGC
CTGAAATATGACGCCAACAATATCTACCTGGCGACCATGTATTCTGAGACCCGCAAAATG
ACCCCGATCAGCGGCGGTTTTGCCAACAAAGCGCAGAACTTTGAAGCGGTGGCGCAGTAT
CAGTTCGACTTCGGTCTGCGTCCGTCCCTCGGC

pyrG (522 bp)
ACGTCCTTGCGCATCGCACTGATTGGCCGTGAGTCAGACCACCGTCTGGTCTACCCCGCC
ACGCTTGGCTCACTGGGTGATGCCGCGGCGTCGCTGGGGCTGAACCTGGAGGTCCATTTC
TTCGCGCCGGTCAGTCTGTCCCCTGGGTTACACGACCTCCACGACGTCCAGGGCGTCGTG
TTGCCAGGCGGTTCCTCGATGGCCGCCGTCAAGGGACAAATCCGCGTGGCGGAAGATACG
CTTGCCCGCGGACAGCCCACGCTGGGGTTATGCCTGGGAATGCAGAGCATGATGACCGCA
GTCGTGCGCCGACGTCCGGGTTGCGAATCAGCCATTCCCGCCGAAGTGGCTCCGGATGAG
GCTCTGCACAGCTTTGTTCCCTTTGTTGATGGCCGTCATCGCTGCGGCGTATTCCCTTTT
TCCTTCGGGTTGATCCCCGGTGATATCCGCGAAATGCACTACAACCATCGCTACTGCTTT
AACACCGACTTATTACCGGCGCTGGATCGCAGCGGGGTCAGC

rpoB (513 bp)
ATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGCGCAGGCTTCGAAGTTCGAGAC
GTACACCCGACGCACTACGGTCGCGTATGTCCAATCGAAACGCCTGAAGGTCCGAACATC
GGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATACGGTTTCCTTGAGACC
CCGTATCGTAAAGTGACCGACGGTGTGGTTACCGATGAAATTCACTACCTGTCTGCTATC
GAAGAAGGCAACTACGTTATTGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCACTTC
GTAGAAGACCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAG
GTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCG
TTCCTGGAGCACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCG
GTTCCGACTCTGCGCGCTGATAAGCCGCTGGTT

tonB (450 bp)
GCGCCGGCCGATCTTGAGCCGCCCCCGGCGGCACAGCCAGTCGTGGAGCCCGTTGTCGAA
CCTGATCCTGAGCCGGAACCCGAGGTGGTGCCTGAACCGCCGAAAGAGGCGCCGGTGGTG
ATCCATAAACCGGAACCGAAGCCGAAGCCTAAACCCAAACCGAAACCCAAGCCGGAGAAA
AAGGTTGAGCAGCCCAGGCGGGACGTGAAGCCGGCAGCAGAGCCGCGTCCGGCCTCGCCG
TTTGAAAACAACAACACGACGCCAGCGCGCACCGCGCCAAGCACCTCGACCGCGGCCGCC
AAACCCACCGTTACTGCCCCGAGCGGCCCGCGGGCGATCAGCCGTGTCCAGCCGACCTAC
CCGGCCCGCGCCCAGGCGCTGCGCATCGAAGGGACGGTGCGGGTGAAGTTTGACGTGACG
CCTGATGGCCGAATCGACAACCTACAGATC

Sequence comparison:

This page was design for assignation of sequence type (ST) of K. variicola isolates, both for Sanger- and for whole genome-type sequencing technologies. In the case of whole genome sequencing we included, first, the ANI (average nucleotide identity; see references below) analysis for proper identification of bacterial species as: K. variicola, K. pneumoniae, K. quasipneumoniae and K. quasivariicola (this last recently described). Only for K. variicola genomes will be determined the sequence tape (ST). In the other cases determines which of the other species corresponds to those included in the analysis.

This considering the following references:

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.
Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. 2007.
Int J Syst Evol Microbiol 57:81–91. 10.1099/ijs.0.64483-0.

Taxonomic affiliation of new genomes should be verified using average nucleotide identity and multilocus phylogenetic analysis.
Figueras MJ, Beaz-Hidalgo R, Hossain MJ, Liles MR. 2014.
Genome Announc. 4;2. pii: e00927-14. doi: 10.1128/genomeA.00927-14

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos.
Salud Publica de Mexico. 2018. 60;1 :56-62.



Download sequences and ST table:


ST table:

ST Origin Sample ESBL Country Accession Strain leuS pgi pgk phoE pyrG rpoB tonB
1 Human Blood SHV-2 Mexico CDMV00000000 801 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2a Mexico 25886267 812 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2a Mexico 25886267 811 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2a Mexico 25886267 809 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2a Mexico 25886267 808 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2a Mexico 25886267 807 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2 Mexico 25886267 806 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Blood SHV-2a Mexico 25886267 805 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
1 Human Urine Unknown USA QIYN01000001.1 WUSM_KV_09 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
2 Human Sputum Negative Mexico CEGG00000000 8917 Leus object (1) Pgi object (2) Pgk object (2) Phoe object (1) Pyrg object (2) Rpob object (1) Tonb object (2)
3 Plant Banana root Negative Mexico CXPC00000000 6A2 Leus object (1) Pgi object (3) Pgk object (3) Phoe object (2) Pyrg object (3) Rpob object (1) Tonb object (3)
3 Plant Maize shoots Negative Mexico CXOY00000000 3 Leus object (1) Pgi object (3) Pgk object (3) Phoe object (2) Pyrg object (3) Rpob object (1) Tonb object (3)
4 Human Abscess CTX-M-15 Mexico CXOZ00000000 06-268 Leus object (1) Pgi object (1) Pgk object (4) Phoe object (2) Pyrg object (4) Rpob object (2) Tonb object (4)
5 Human Blood Negative Mexico CXPB00000000 4880 Leus object (1) Pgi object (4) Pgk object (5) Phoe object (3) Pyrg object (1) Rpob object (1) Tonb object (3)
6 Plant Sugar cane stem Negative Mexico CXPA00000000 T29A Leus object (2) Pgi object (5) Pgk object (6) Phoe object (4) Pyrg object (5) Rpob object (1) Tonb object (5)
7 Insect Fungus matrix Negative Panama CP001891.1 At-22 Leus object (3) Pgi object (1) Pgk object (7) Phoe object (1) Pyrg object (6) Rpob object (3) Tonb object (6)
8 Plant Maize stems Negative USA CP000964.1 342 Leus object (1) Pgi object (6) Pgk object (8) Phoe object (5) Pyrg object (7) Rpob object (1) Tonb object (7)
9 Plant Banana root Negative China CP009274 DX120E Leus object (1) Pgi object (6) Pgk object (9) Phoe object (1) Pyrg object (8) Rpob object (1) Tonb object (8)
10 Human Gut Unknown Denmark CBBA000000000 CAG:634 Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
10 Human Blood Unknown China NZ_CP030173.1 13450 Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
10 Human Wound swab Unknown Tanzania OVDM01000001.1 KCRI-198C Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
10 Human Sputum Unknown Tanzania OVDP01000001.1 KCRI-201B Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
10 Human Respiratory SHV-30 USA SRX2681986 KPN1264 Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
10 Human Urine Unknown USA QIXS01000001.1 WUSM_KV_30 Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
10 Human Urine Unknown USA QIXM01000001.1 WUSM_KV_36 Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
11 Plant Banana root Unknown China CP010523 DSM15968 Leus object (4) Pgi object (7) Pgk object (5) Phoe object (1) Pyrg object (10) Rpob object (1) Tonb object (2)
11 Plant Banana root Negative Mexico 15053318 F2R9 (ATCC BAA-830) Leus object (4) Pgi object (7) Pgk object (5) Phoe object (1) Pyrg object (10) Rpob object (1) Tonb object (2)
12 Human Faeces Negative Brazil JDWA00000000 BZ19 Leus object (5) Pgi object (8) Pgk object (11) Phoe object (1) Pyrg object (11) Rpob object (1) Tonb object (10)
13 Insect Nezara viridula Negative USA CP008700.1 KP5-1 Leus object (6) Pgi object (6) Pgk object (4) Phoe object (7) Pyrg object (11) Rpob object (1) Tonb object (2)
14 Human Pus Unknown Malaysia JRTV00000000 223/14 Leus object (7) Pgi object (3) Pgk object (6) Phoe object (8) Pyrg object (12) Rpob object (4) Tonb object (2)
15 Plant Bitter gourd Unknown Malaysia JSWX00000000 B1 Leus object (8) Pgi object (4) Pgk object (12) Phoe object (9) Pyrg object (1) Rpob object (1) Tonb object (4)
16 Plant Chili Unknown Malaysia JSXA00000000 CH4 Leus object (9) Pgi object (3) Pgk object (12) Phoe object (8) Pyrg object (3) Rpob object (5) Tonb object (2)
16 Human Urine Unknown USA JMWB00000000 BIDMC61 Leus object (9) Pgi object (3) Pgk object (12) Phoe object (8) Pyrg object (3) Rpob object (5) Tonb object (2)
17 Human Respiratory Unknown USA AYJK00000000 MGH20 Leus object (1) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (4) Rpob object (1) Tonb object (2)
18 missing Urine Unknown USA AYIX00000000 MGH40 Leus object (10) Pgi object (9) Pgk object (6) Phoe object (1) Pyrg object (13) Rpob object (1) Tonb object (11)
19 missing Missing Unknown USA AYIF00000000 UCICRE10 Leus object (1) Pgi object (4) Pgk object (1) Phoe object (1) Pyrg object (11) Rpob object (1) Tonb object (2)
20 Human Urine Unknown USA JCML00000000 UCI18 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Missing Unknown USA LFAP00000000 MGH114 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Unknown Unknown Germany UIDW01000001.1 ID_2 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Unknown Unknown Germany UIDT01000001.1 ID_5 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Unknown Unknown Germany UIDV01000001.1 ID_6 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Unknown Unknown Germany UIDM01000001.1 ID_8 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Unknown Unknown Germany UIDI01000001.1 ID_11 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
20 Human Urine Unknown USA QIXC01000001.1 WUSM_KV_46 Leus object (1) Pgi object (10) Pgk object (2) Phoe object (10) Pyrg object (14) Rpob object (1) Tonb object (2)
21 Human Urine Unknown USA JMZD00000000 MGH68 Leus object (11) Pgi object (5) Pgk object (5) Phoe object (11) Pyrg object (11) Rpob object (1) Tonb object (12)
22 Human Urine Unknown USA JMZM00000000 MGH80 Leus object (11) Pgi object (3) Pgk object (6) Phoe object (12) Pyrg object (11) Rpob object (6) Tonb object (2)
23 Human Missing Unknown USA LFBA00000000 BIDMC88 Leus object (1) Pgi object (11) Pgk object (10) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
24 Human Missing Unknown USA LFBC00000000 BIDMC90 Leus object (12) Pgi object (12) Pgk object (10) Phoe object (1) Pyrg object (15) Rpob object (1) Tonb object (13)
25 Human Missing Unknown USA LFAD00000000 MGH92 Leus object (9) Pgi object (13) Pgk object (13) Phoe object (13) Pyrg object (7) Rpob object (1) Tonb object (3)
26 Human Missing Unknown USA ACXA00000000 1.1.55 Leus object (9) Pgi object (10) Pgk object (13) Phoe object (13) Pyrg object (7) Rpob object (1) Tonb object (14)
27 Human Missing Unknown USA ASQN00000000 KTE92 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (1) Pyrg object (16) Rpob object (4) Tonb object (2)
28 Human Blood Negative Mexico 15053318 1109 Leus object (1) Pgi object (1) Pgk object (4) Phoe object (2) Pyrg object (17) Rpob object (2) Tonb object (2)
29 Human Catheter Negative Mexico 15053318 1171 Leus object (1) Pgi object (4) Pgk object (3) Phoe object (14) Pyrg object (18) Rpob object (1) Tonb object (3)
30 Human Secretion Negative Mexico 25886267 9351 Leus object (1) Pgi object (14) Pgk object (5) Phoe object (1) Pyrg object (19) Rpob object (1) Tonb object (2)
31 Human Biliary liquids Negative Mexico 25886267 9353 Leus object (13) Pgi object (15) Pgk object (1) Phoe object (1) Pyrg object (20) Rpob object (1) Tonb object (2)
32 Human Abscess Negative Mexico 25886267 9925 Leus object (14) Pgi object (16) Pgk object (14) Phoe object (15) Pyrg object (21) Rpob object (7) Tonb object (2)
32 Human Blood Negative Mexico 26571390 10239 Leus object (14) Pgi object (16) Pgk object (14) Phoe object (15) Pyrg object (21) Rpob object (7) Tonb object (2)
32 Human Sputum Negative USA JVTE01000001 1335_KPNE Leus object (14) Pgi object (16) Pgk object (14) Phoe object (15) Pyrg object (21) Rpob object (7) Tonb object (2)
32 Human Blood Negative USA SRX2682028 KPN700 Leus object (14) Pgi object (16) Pgk object (14) Phoe object (15) Pyrg object (21) Rpob object (7) Tonb object (2)
33 Plant Banana stem Negative Mexico 15053318 VI Leus object (15) Pgi object (6) Pgk object (6) Phoe object (1) Pyrg object (22) Rpob object (1) Tonb object (2)
34 Plant Rice roots Negative Mexico 15053318 CFN2006 Leus object (1) Pgi object (3) Pgk object (5) Phoe object (16) Pyrg object (1) Rpob object (8) Tonb object (2)
35 Human Vaginal secretion Negative Mexico 29692906 10447 Leus object (16) Pgi object (1) Pgk object (5) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (2)
36 Human Missing Negative Mexico This work 9271 Leus object (1) Pgi object (4) Pgk object (15) Phoe object (2) Pyrg object (23) Rpob object (9) Tonb object (2)
37 Human Missing Negative Mexico This work 9274 Leus object (17) Pgi object (17) Pgk object (1) Phoe object (1) Pyrg object (24) Rpob object (1) Tonb object (2)
38 Human Missing Negative Mexico This work 11212 Leus object (1) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (1) Rpob object (1) Tonb object (9)
39 Human Missing Negative Mexico This work 11214 Leus object (11) Pgi object (6) Pgk object (13) Phoe object (2) Pyrg object (25) Rpob object (3) Tonb object (15)
40 Human Missing Negative Mexico This work 11226 Leus object (1) Pgi object (18) Pgk object (16) Phoe object (17) Pyrg object (1) Rpob object (10) Tonb object (2)
41 Human Missing Negative Mexico This work 11248 Leus object (2) Pgi object (5) Pgk object (10) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (2)
42 Human Missing Negative Mexico This work 11254 Leus object (18) Pgi object (6) Pgk object (4) Phoe object (1) Pyrg object (1) Rpob object (6) Tonb object (2)
43 Human Missing Negative Mexico This work 11435 Leus object (17) Pgi object (17) Pgk object (1) Phoe object (1) Pyrg object (26) Rpob object (1) Tonb object (16)
44 Human Missing Negative Mexico This work 11463 Leus object (12) Pgi object (19) Pgk object (13) Phoe object (1) Pyrg object (27) Rpob object (1) Tonb object (2)
45 Human Missing Negative Mexico This work 11436 Leus object (1) Pgi object (1) Pgk object (6) Phoe object (18) Pyrg object (28) Rpob object (1) Tonb object (3)
46 Plant Sugarcane rhizosphere soil Negative Mexico This work KvMx3 Leus object (2) Pgi object (5) Pgk object (17) Phoe object (19) Pyrg object (1) Rpob object (1) Tonb object (17)
47 Plant Sugarcane root Negative Mexico This work KvMx4 Leus object (19) Pgi object (15) Pgk object (6) Phoe object (20) Pyrg object (22) Rpob object (1) Tonb object (17)
48 Plant Maize rhizosphere soil Negative Mexico This work KvMx18 Leus object (11) Pgi object (10) Pgk object (18) Phoe object (1) Pyrg object (4) Rpob object (1) Tonb object (2)
49 Human Sputum Unknown USA JVDU01000001.1 521_SSON Leus object (1) Pgi object (20) Pgk object (6) Phoe object (21) Pyrg object (1) Rpob object (7) Tonb object (2)
49 Human Bronchoalveolar Lavage Unknown USA JVDR01000001.1 524_SBOY Leus object (1) Pgi object (20) Pgk object (6) Phoe object (21) Pyrg object (1) Rpob object (7) Tonb object (2)
49 Human Sputum Unknown USA JUYL01000001.1 653_KVAR Leus object (1) Pgi object (20) Pgk object (6) Phoe object (21) Pyrg object (1) Rpob object (7) Tonb object (2)
50 Human Fluid Unknown USA JUXS01000001.1 671_KVAR Leus object (1) Pgi object (3) Pgk object (6) Phoe object (22) Pyrg object (3) Rpob object (8) Tonb object (2)
51 Human Tracheal Aspirate Unknown USA JUTF01000001.1 780_KPNE Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
51 Human Tracheal Aspirate Unknown USA JURI01000001.1 833_KPNE Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
51 Human Tracheal Aspirate Unknown USA JURH01000001.1 834_KPNE Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
51 Human Tracheal Aspirate Unknown USA JURG01000001.1 835_KPNE Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
51 Human Tracheal Aspirate Unknown USA JURF01000001.1 836_KPNE Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
51 Human Tracheal Aspirate Unknown USA JURE01000001.1 837_KPNE Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
51 Human Urine catheter Unknown USA QIYM01000001.1 WUSM_KV_10 Leus object (1) Pgi object (20) Pgk object (1) Phoe object (23) Pyrg object (29) Rpob object (9) Tonb object (5)
52 Human Urine, Catheterized Unknown USA JUSW01000001.1 789_KVAR Leus object (1) Pgi object (4) Pgk object (3) Phoe object (24) Pyrg object (11) Rpob object (1) Tonb object (2)
53 Human Body fluid Unknown USA PTGT01000001.1 1565/2503 Leus object (1) Pgi object (21) Pgk object (1) Phoe object (25) Pyrg object (30) Rpob object (11) Tonb object (2)
54 Human Unknown Unknown Vietnam ERR025463 1892m Leus object (1) Pgi object (5) Pgk object (5) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (18)
55 Human Missing Negative Mexico This work 11446 Leus object (20) Pgi object (22) Pgk object (19) Phoe object (26) Pyrg object (31) Rpob object (12) Tonb object (19)
56 Human Unknown Unknown Australia ERS005747 AJ026 Leus object (21) Pgi object (18) Pgk object (3) Phoe object (2) Pyrg object (1) Rpob object (13) Tonb object (2)
56 Human Unknown Unknown Australia ERS005771 AJ182 Leus object (21) Pgi object (18) Pgk object (3) Phoe object (2) Pyrg object (1) Rpob object (13) Tonb object (2)
56 Human Urine Unknown USA QIYF01000001.1 WUSM_KV_17 Leus object (21) Pgi object (18) Pgk object (3) Phoe object (2) Pyrg object (1) Rpob object (13) Tonb object (2)
56 Human Urine Unknown USA QIXD01000001.1 WUSM_KV_45 Leus object (21) Pgi object (18) Pgk object (3) Phoe object (2) Pyrg object (1) Rpob object (13) Tonb object (2)
57 Human Unknown Unknown Australia ERS005754 AJ135 Leus object (22) Pgi object (6) Pgk object (6) Phoe object (27) Pyrg object (1) Rpob object (1) Tonb object (14)
57 Human Blood Unknown Netherlands JXJH01000001.1 KP-21F Leus object (22) Pgi object (6) Pgk object (6) Phoe object (27) Pyrg object (1) Rpob object (1) Tonb object (14)
58 Human Unknown Unknown Australia ERS005778 AJ292 Leus object (6) Pgi object (4) Pgk object (1) Phoe object (28) Pyrg object (32) Rpob object (14) Tonb object (2)
59 missing Missing Negative USA MPCI01000001.1 AR_0016 Leus object (23) Pgi object (19) Pgk object (5) Phoe object (29) Pyrg object (2) Rpob object (1) Tonb object (3)
59 Human Urine Unknown USA QIXW01000001.1 WUSM_KV_26 Leus object (23) Pgi object (19) Pgk object (5) Phoe object (29) Pyrg object (2) Rpob object (1) Tonb object (3)
60 Human Blood Unknown Bangladesh PJOO01000001.1 BD.DM.165 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
61 Human Missing Unknown USA NGSO01000001.1 BIDMC117 Leus object (1) Pgi object (9) Pgk object (6) Phoe object (1) Pyrg object (13) Rpob object (1) Tonb object (2)
61 Human Urine Unknown USA QIXP01000001.1 WUSM_KV_33 Leus object (1) Pgi object (9) Pgk object (6) Phoe object (1) Pyrg object (13) Rpob object (1) Tonb object (2)
62 Human Missing Unknown USA NGSP01000001.1 BIDMC118 Leus object (1) Pgi object (5) Pgk object (5) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (15)
63 Environmental Soil Unknown Singapure CP013985.1 LMG23571 Leus object (2) Pgi object (5) Pgk object (10) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (20)
64 Plant Roots of tall fescue Negative China LOAR00000000 D5A Leus object (10) Pgi object (9) Pgk object (6) Phoe object (1) Pyrg object (32) Rpob object (1) Tonb object (2)
64 Human Unknown Unknown Germany UIDS01000001.1 ID_24 Leus object (10) Pgi object (9) Pgk object (6) Phoe object (1) Pyrg object (32) Rpob object (1) Tonb object (2)
65 Plant Roots Maize Unknown China NZ_CP016344.1 E57-7 Leus object (9) Pgi object (3) Pgk object (12) Phoe object (31) Pyrg object (3) Rpob object (5) Tonb object (2)
66 Environmental River water NDM-9 South Korea NZ_CP017284.1 GJ1 Leus object (1) Pgi object (3) Pgk object (6) Phoe object (8) Pyrg object (11) Rpob object (1) Tonb object (2)
66 Environmental River water NDM-9 South Korea NZ_CP017849.1 GJ2 Leus object (1) Pgi object (3) Pgk object (6) Phoe object (8) Pyrg object (11) Rpob object (1) Tonb object (2)
66 Environmental River water CTX-M-65/NDM-9 South Korea NZ_CP017289.1 GJ3 Leus object (1) Pgi object (3) Pgk object (6) Phoe object (8) Pyrg object (11) Rpob object (1) Tonb object (2)
67 Human Unknown Unknown China MOSU00000000 H39 Leus object (24) Pgi object (3) Pgk object (1) Phoe object (32) Pyrg object (33) Rpob object (15) Tonb object (3)
68 Human Unknown Unknown Germany UIDY01000001.1 ID_16 Leus object (13) Pgi object (23) Pgk object (5) Phoe object (33) Pyrg object (19) Rpob object (1) Tonb object (2)
68 Human Unknown Unknown Germany UIDU01000001.1 ID_18 Leus object (13) Pgi object (23) Pgk object (5) Phoe object (33) Pyrg object (19) Rpob object (1) Tonb object (2)
68 Human Unknown Unknown Germany UIEF01000001.1 ID_19 Leus object (13) Pgi object (23) Pgk object (5) Phoe object (33) Pyrg object (19) Rpob object (1) Tonb object (2)
69 Human Unknown Unknown Germany UIFG01000001.1 ID_43 Leus object (13) Pgi object (23) Pgk object (5) Phoe object (34) Pyrg object (19) Rpob object (1) Tonb object (2)
70 Human Unknown Unknown Germany UIFD01000001.1 ID_49 Leus object (1) Pgi object (18) Pgk object (6) Phoe object (1) Pyrg object (34) Rpob object (13) Tonb object (21)
71 Human Blood Unknown China NPGY01000001.1 K2631 Leus object (25) Pgi object (21) Pgk object (3) Phoe object (35) Pyrg object (35) Rpob object (1) Tonb object (22)
72 Human Wound swab Unknown Tanzania OVDF01000001.1 KCRI-152E Leus object (26) Pgi object (10) Pgk object (1) Phoe object (36) Pyrg object (1) Rpob object (13) Tonb object (2)
73 Human Catheter Unknown Colombia MSZI01000001.1 KP007 Leus object (9) Pgi object (4) Pgk object (6) Phoe object (24) Pyrg object (1) Rpob object (1) Tonb object (23)
74 Human Urine SHV-12 USA SRX2681305 KPN325 Leus object (19) Pgi object (5) Pgk object (5) Phoe object (6) Pyrg object (10) Rpob object (1) Tonb object (22)
75 Human Blood SHV-12 USA SRX2680563 KPN458 Leus object (11) Pgi object (9) Pgk object (6) Phoe object (20) Pyrg object (1) Rpob object (13) Tonb object (2)
76 Human Urine CTX-M-15 USA SRX2681541 KPN807 Leus object (27) Pgi object (4) Pgk object (3) Phoe object (1) Pyrg object (35) Rpob object (1) Tonb object (24)
77 Human Respiratory KPC-2 USA SRX2681803 KPN1401 Leus object (1) Pgi object (1) Pgk object (20) Phoe object (1) Pyrg object (1) Rpob object (11) Tonb object (25)
77 Human Respiratory KPC-2 USA SRX2681790 KPN1415 Leus object (1) Pgi object (1) Pgk object (20) Phoe object (1) Pyrg object (1) Rpob object (11) Tonb object (25)
78 Human Urine CTX-M-15/NDM-1 USA SRX2681713 KPN1481 Leus object (28) Pgi object (24) Pgk object (5) Phoe object (37) Pyrg object (36) Rpob object (1) Tonb object (4)
79 Human Wound SHV-12 USA SRX2681646 KPN1556 Leus object (11) Pgi object (1) Pgk object (3) Phoe object (1) Pyrg object (11) Rpob object (1) Tonb object (2)
79 Human Urine Unknown USA QIWX01000001.1 WUSM_KV_51 Leus object (11) Pgi object (1) Pgk object (3) Phoe object (1) Pyrg object (11) Rpob object (1) Tonb object (2)
80 Human Urine SHV-12, SHV-66 USA SRX2681570 KPN1751 Leus object (1) Pgi object (6) Pgk object (10) Phoe object (3) Pyrg object (37) Rpob object (1) Tonb object (2)
81 Human Urine Unknown India LZGB01000001.1 KV093 Leus object (15) Pgi object (6) Pgk object (1) Phoe object (1) Pyrg object (38) Rpob object (14) Tonb object (26)
82 Plant/Fungi Mycorrhiza of Pisolithus tinctorius Unknown China LQMR01000001.1 KV321 Leus object (29) Pgi object (4) Pgk object (6) Phoe object (1) Pyrg object (1) Rpob object (14) Tonb object (15)
83 Human Catheter Negative Mexico This work 9635 Leus object (2) Pgi object (6) Pgk object (12) Phoe object (38) Pyrg object (39) Rpob object (16) Tonb object (4)
84 Plant Root of a sugarcane plant Negative Mexico FLLH01000001 KvMx2 Leus object (30) Pgi object (25) Pgk object (21) Phoe object (39) Pyrg object (40) Rpob object (17) Tonb object (27)
85 Human Faeces Unknown China NLDD01000001 L18 Leus object (31) Pgi object (24) Pgk object (22) Phoe object (40) Pyrg object (41) Rpob object (1) Tonb object (28)
86 Environmental Industrial effluent Unknown Pakistan MSCS01000001 MB351 Leus object (11) Pgi object (26) Pgk object (2) Phoe object (41) Pyrg object (1) Rpob object (1) Tonb object (2)
87 Animal Bovine Unknown Canada LFYK01000000 NL58 Leus object (1) Pgi object (10) Pgk object (14) Phoe object (42) Pyrg object (2) Rpob object (13) Tonb object (2)
87 Animal Bovine Unknown Canada LGAW01000000 NL49 Leus object (1) Pgi object (10) Pgk object (14) Phoe object (42) Pyrg object (2) Rpob object (13) Tonb object (2)
88 Animal Bovine - Intestinal Unknown USA ERS011908 QMP_B2-288 Leus object (11) Pgi object (27) Pgk object (5) Phoe object (41) Pyrg object (1) Rpob object (1) Tonb object (2)
89 Animal Bovine - Intestinal Unknown USA ERS011920 QMP_B2-340 Leus object (13) Pgi object (28) Pgk object (3) Phoe object (9) Pyrg object (1) Rpob object (1) Tonb object (2)
89 Animal Bovine - Intestinal Unknown USA ERS011926 QMP_B2-483 Leus object (13) Pgi object (28) Pgk object (3) Phoe object (9) Pyrg object (1) Rpob object (1) Tonb object (2)
90 Animal Bovine - Intestinal Unknown USA ERS011925 QMP_B2-481 Leus object (2) Pgi object (1) Pgk object (3) Phoe object (38) Pyrg object (4) Rpob object (18) Tonb object (13)
91 Animal Bovine - Intestinal Unknown USA ERS011933 QMP_M1-043 Leus object (1) Pgi object (17) Pgk object (1) Phoe object (25) Pyrg object (42) Rpob object (1) Tonb object (2)
92 Animal Unknown Unknown USA ERS011961 QMP_M1-428 Leus object (32) Pgi object (29) Pgk object (3) Phoe object (24) Pyrg object (35) Rpob object (19) Tonb object (4)
93 Animal Urine Unknown USA ERS011977 QMP_M1-893 Leus object (33) Pgi object (6) Pgk object (1) Phoe object (11) Pyrg object (43) Rpob object (1) Tonb object (29)
94 Human Missing Unknown China PWAV01000001.1 SCKV020062 Leus object (1) Pgi object (6) Pgk object (23) Phoe object (43) Pyrg object (1) Rpob object (1) Tonb object (2)
94 Human Missing Unknown China PWAU01000001.1 SCKV020067 Leus object (1) Pgi object (6) Pgk object (23) Phoe object (43) Pyrg object (1) Rpob object (1) Tonb object (2)
94 Human Missing Unknown China PWAT01000001.1 SCKV020069 Leus object (1) Pgi object (6) Pgk object (23) Phoe object (43) Pyrg object (1) Rpob object (1) Tonb object (2)
94 Human Unknown Unknown China NZ_CP028555.1 WCHKP19 Leus object (1) Pgi object (6) Pgk object (23) Phoe object (43) Pyrg object (1) Rpob object (1) Tonb object (2)
95 Human Missing Unknown China NWEW01000001.1 SCKV020148 Leus object (1) Pgi object (3) Pgk object (3) Phoe object (2) Pyrg object (3) Rpob object (20) Tonb object (3)
96 Human Missing Unknown South Africa NXJG01000001.1 ST-1791-KOO1 Leus object (34) Pgi object (6) Pgk object (6) Phoe object (1) Pyrg object (35) Rpob object (1) Tonb object (30)
97 Environmental GM-anode biofilm Unknown Missing DBMQ01000001.1 UBA694 Leus object (18) Pgi object (24) Pgk object (5) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (2)
98 Environmental Metal Unknown USA DFCX01000001.1 UBA3043 Leus object (11) Pgi object (30) Pgk object (6) Phoe object (1) Pyrg object (35) Rpob object (1) Tonb object (30)
99 Environmental Metal/Plastic Unknown USA DFSA01000001.1 UBA3449 Leus object (11) Pgi object (4) Pgk object (10) Phoe object (6) Pyrg object (44) Rpob object (8) Tonb object (31)
100 Environmental Metal/Plastic Unknown USA DGAC01000001.1 UBA4040 Leus object (13) Pgi object (24) Pgk object (6) Phoe object (30) Pyrg object (1) Rpob object (1) Tonb object (2)
101 Human Unknown Unknown China NZ_CP027064.2 WCHKV030666 Leus object (28) Pgi object (31) Pgk object (5) Phoe object (37) Pyrg object (1) Rpob object (1) Tonb object (2)
102 Human Unknown Unknown China NWEJ01000001.1 WCHKV030937 Leus object (35) Pgi object (4) Pgk object (6) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (9)
103 Human Urine Unknown USA QIYV01000001.1 WUSM_KV_01 Leus object (6) Pgi object (24) Pgk object (5) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (28)
104 Human Unknown Unknown USA QIYU01000001.1 WUSM_KV_02 Leus object (2) Pgi object (5) Pgk object (6) Phoe object (3) Pyrg object (5) Rpob object (1) Tonb object (5)
105 Human Aspirate, left breast Unknown USA QIYT01000001.1 WUSM_KV_03 Leus object (23) Pgi object (19) Pgk object (2) Phoe object (8) Pyrg object (45) Rpob object (1) Tonb object (2)
106 Human Tracheal Aspirate Unknown USA QIYS01000001.1 WUSM_KV_04 Leus object (21) Pgi object (18) Pgk object (3) Phoe object (2) Pyrg object (1) Rpob object (13) Tonb object (32)
107 Human Sputum Unknown USA QIYQ01000001.1 WUSM_KV_06 Leus object (36) Pgi object (6) Pgk object (10) Phoe object (3) Pyrg object (37) Rpob object (1) Tonb object (2)
107 Human Urine Unknown USA QIXK01000001.1 WUSM_KV_38 Leus object (36) Pgi object (6) Pgk object (10) Phoe object (3) Pyrg object (37) Rpob object (1) Tonb object (2)
107 Human Wound Unknown USA QIWZ01000001.1 WUSM_KV_49 Leus object (36) Pgi object (6) Pgk object (10) Phoe object (3) Pyrg object (37) Rpob object (1) Tonb object (2)
108 Human Urine Unknown USA QIYP01000001.1 WUSM_KV_07 Leus object (2) Pgi object (27) Pgk object (6) Phoe object (2) Pyrg object (1) Rpob object (13) Tonb object (15)
109 Human Drainage, left groin Unknown USA QIYO01000001.1 WUSM_KV_08 Leus object (2) Pgi object (6) Pgk object (1) Phoe object (25) Pyrg object (32) Rpob object (11) Tonb object (1)
109 Human Tibia Unknown USA QIYL01000001.1 WUSM_KV_11 Leus object (2) Pgi object (6) Pgk object (1) Phoe object (25) Pyrg object (32) Rpob object (11) Tonb object (1)
110 Human Urine Unknown USA QIYK01000001.1 WUSM_KV_12 Leus object (5) Pgi object (32) Pgk object (5) Phoe object (44) Pyrg object (46) Rpob object (13) Tonb object (2)
111 Human Urine Unknown USA QIYJ01000001.1 WUSM_KV_13 Leus object (37) Pgi object (33) Pgk object (1) Phoe object (3) Pyrg object (37) Rpob object (7) Tonb object (33)
112 Human Blood Unknown USA QIYI01000001.1 WUSM_KV_14 Leus object (38) Pgi object (34) Pgk object (24) Phoe object (45) Pyrg object (47) Rpob object (1) Tonb object (2)
112 Human Urine Unknown USA QIYD01000001.1 WUSM_KV_19 Leus object (38) Pgi object (34) Pgk object (24) Phoe object (45) Pyrg object (47) Rpob object (1) Tonb object (2)
113 Human Wound, drain right lower quadrant Unknown USA QIYH01000001.1 WUSM_KV_15 Leus object (17) Pgi object (17) Pgk object (1) Phoe object (1) Pyrg object (24) Rpob object (1) Tonb object (16)
114 Human Blood Unknown USA QIYG01000001.1 WUSM_KV_16 Leus object (39) Pgi object (1) Pgk object (1) Phoe object (1) Pyrg object (1) Rpob object (1) Tonb object (1)
115 Human Urine Unknown USA QIYE01000001.1 WUSM_KV_18 Leus object (11) Pgi object (1) Pgk object (6) Phoe object (46) Pyrg object (48) Rpob object (2) Tonb object (2)
116 Human Urine Unknown USA QIYB01000001.1 WUSM_KV_21 Leus object (40) Pgi object (27) Pgk object (6) Phoe object (3) Pyrg object (1) Rpob object (13) Tonb object (15)
117 Human Urine Unknown USA QIYA01000001.1 WUSM_KV_22 Leus object (41) Pgi object (5) Pgk object (6) Phoe object (8) Pyrg object (4) Rpob object (2) Tonb object (2)
117 Human Urine Unknown USA QIXZ01000001.1 WUSM_KV_23 Leus object (41) Pgi object (5) Pgk object (6) Phoe object (8) Pyrg object (4) Rpob object (2) Tonb object (2)
117 Human Blood Unknown USA QIXY01000001.1 WUSM_KV_24 Leus object (41) Pgi object (5) Pgk object (6) Phoe object (8) Pyrg object (4) Rpob object (2) Tonb object (2)
118 Human Blood Unknown USA QIXX01000001.1 WUSM_KV_25 Leus object (14) Pgi object (1) Pgk object (6) Phoe object (1) Pyrg object (36) Rpob object (1) Tonb object (15)
118 Human Urine Unknown USA QIXN01000001.1 WUSM_KV_35 Leus object (14) Pgi object (1) Pgk object (6) Phoe object (1) Pyrg object (36) Rpob object (1) Tonb object (15)
119 Human Urine Unknown USA QIXV01000001.1 WUSM_KV_27 Leus object (1) Pgi object (28) Pgk object (6) Phoe object (43) Pyrg object (49) Rpob object (13) Tonb object (2)
120 Human Urine Unknown USA QIXU01000001.1 WUSM_KV_28 Leus object (11) Pgi object (23) Pgk object (6) Phoe object (1) Pyrg object (35) Rpob object (1) Tonb object (3)
121 Human Urine Unknown USA QIXT01000001.1 WUSM_KV_29 Leus object (2) Pgi object (4) Pgk object (6) Phoe object (24) Pyrg object (4) Rpob object (21) Tonb object (2)
121 Human Urine Unknown USA QIXQ01000001.1 WUSM_KV_32 Leus object (2) Pgi object (4) Pgk object (6) Phoe object (24) Pyrg object (4) Rpob object (21) Tonb object (2)
122 Human Urine Unknown USA QIXR01000001.1 WUSM_KV_31 Leus object (42) Pgi object (1) Pgk object (3) Phoe object (47) Pyrg object (1) Rpob object (7) Tonb object (30)
123 Human Urine Unknown USA QIXL01000001.1 WUSM_KV_37 Leus object (41) Pgi object (5) Pgk object (6) Phoe object (8) Pyrg object (35) Rpob object (2) Tonb object (34)
124 Human Urine Unknown USA QIXJ01000001.1 WUSM_KV_39 Leus object (1) Pgi object (18) Pgk object (12) Phoe object (1) Pyrg object (34) Rpob object (13) Tonb object (21)
125 Human Urine Unknown USA QIXH01000001.1 WUSM_KV_41 Leus object (35) Pgi object (27) Pgk object (6) Phoe object (3) Pyrg object (1) Rpob object (13) Tonb object (15)
126 Human Urine Unknown USA QIXE01000001.1 WUSM_KV_44 Leus object (38) Pgi object (35) Pgk object (1) Phoe object (1) Pyrg object (35) Rpob object (1) Tonb object (2)
127 Human Urine Unknown USA QIXA01000001.1 WUSM_KV_48 Leus object (11) Pgi object (9) Pgk object (6) Phoe object (20) Pyrg object (1) Rpob object (13) Tonb object (35)
128 Human Bronch wash Unknown USA QIWY01000001.1 WUSM_KV_50 Leus object (5) Pgi object (8) Pgk object (7) Phoe object (40) Pyrg object (11) Rpob object (11) Tonb object (10)
129 Human Urine Unknown USA QIWW01000001.1 WUSM_KV_52 Leus object (1) Pgi object (3) Pgk object (12) Phoe object (1) Pyrg object (1) Rpob object (10) Tonb object (2)
130 Human Urine Unknown USA QIWV01000001.1 WUSM_KV_53 Leus object (9) Pgi object (4) Pgk object (5) Phoe object (1) Pyrg object (32) Rpob object (13) Tonb object (2)
131 Human Blood Unknown USA QIWU01000001.1 WUSM_KV_54 Leus object (43) Pgi object (1) Pgk object (3) Phoe object (38) Pyrg object (4) Rpob object (1) Tonb object (4)
132 Human BAL Unknown USA QIWT01000001.1 WUSM_KV_55 Leus object (1) Pgi object (19) Pgk object (1) Phoe object (38) Pyrg object (1) Rpob object (1) Tonb object (36)
133 Human UR CVS Unknown USA QIVS01000001.1 WUSM_KV_82 Leus object (1) Pgi object (10) Pgk object (6) Phoe object (45) Pyrg object (22) Rpob object (7) Tonb object (2)
134 Human Blood Unknown USA QIVD01000001.1 WUSM_KV_97 Leus object (1) Pgi object (36) Pgk object (1) Phoe object (48) Pyrg object (35) Rpob object (1) Tonb object (37)
135 Human Blood Unknown USA QIUP01000001.1 WUSM_KV_111 Leus object (13) Pgi object (6) Pgk object (6) Phoe object (41) Pyrg object (50) Rpob object (2) Tonb object (2)
136 Human Missing Unknown USA PGIO01000001.1 YD626-2 Leus object (1) Pgi object (4) Pgk object (5) Phoe object (6) Pyrg object (9) Rpob object (1) Tonb object (9)
60 Human Blood CTX-M-15 Bangladesh QUAA01000001 BD_DM_32 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15 Bangladesh QTZQ01000001.1 BD_DM_33 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZR01000001.1 BD_DM_97 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZS01000001.1 BD_DM_115 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZT01000001.1 BD_DM_166 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15/NDM-1 Bangladesh QTZU01000001.1 BD_DM_167 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15 Bangladesh QTZV01000001.1 BD_DM_169 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15 Bangladesh QTZW01000001.1 BD_DM_322 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15 Bangladesh QTZX01000001.1 BD_DM_323 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)
60 Human Blood CTX-M-15 Bangladesh QTZY01000001.1 BD_DM_395 Leus object (11) Pgi object (6) Pgk object (5) Phoe object (30) Pyrg object (16) Rpob object (4) Tonb object (2)


Who is Klebsiella variicola?

K. variicola is a Gram-negative, facultative anaerobic, non-spore-forming, non-motile rod. Its form is circular, convex and smooth colonies and grows around 11-41ºC. K. variicola was initially identified as endophyte in plants and pathogen in humans. However, according to different reports it could be considered ubiquitous in nature. According to its description in the literature, K. variicola can be found in soil, water, plants, insects, humans and animals. In all of them K. variicola plays different roles as; endophyte in plants, as pathogen in humans and animals and symbiont in insects.

Recent publication about K. variicola:

Genome misclassification of Klebsiella variicola and Klebsiella quasipneumoniae isolated from plants, animals and humans.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jesús Silva-Sanchez, Humberto Barrios-Camacho, Ernesto Perez-Rueda, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :29-40. Download

Klebsiella variicola and Klebsiella quasipneumoniae genomic analysis provides insights into their capacity to adapt to clinical and plant settings.
Esperanza Martínez-Romero, Nadia Rodriguez-Medina, Marilu Beltrán-Rojel, Jeiry Toribio-Jimenez, Ulises Garza-Ramos. Salud Publica de Mexico. 2018. 60;1 :56-62. Download

Hypervirulence and hypermucoviscosity: Two different but complementary Klebsiella spp. phenotypes?
Catalán-Nájera JC, Garza-Ramos U, Barrios-Camacho H. Virulence. 2017. Oct 3;8(7):1111-1123. Download

Identification and Characterization of Imipenem-Resistant Klebsiella pneumoniae and Susceptible Klebsiella variicola Isolates Obtained from the Same Patient.
Garza-Ramos U*, Moreno-Dominguez S, Hernández-Castro R, Silva-Sanchez J, Barrios H, Reyna-Flores F, Sanchez-Perez A, Carrillo-Casas EM, Sanchez-León MC, Moncada-Barron D.. Microb Drug Resist. 2016 Apr;22(3):179-84. Download

Draft genome sequences of the Klebsiella variicola plant isolates.
Martinez-Romero Esperanza, Jesús Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesús Martínez-Barnetche, Juan Téllez-Sosa, Rosa Elena Gómez-Barreto, Ulises Garza-Ramos. Genome Announc. 2015 Sep 10;3(5). Download

Draft genome sequence of the first hypermucoviscous Klebsiella variicola clinical isolate.
Ulises Garza-Ramos; Jesus Silva-Sanchez, Humberto Barrios, Nadia Rodriguez-Medina, Jesus Martínez-Barnetche, Veronica Andrade. Genome Announc. 2015 Apr 9;3(2). Download

Development of a multiplex-PCR probe system for proper identification of Klebsiella variicola.
Ulises Garza-Ramos, Jesús Silva-Sánchez, Esperanza Martínez-Romero, Perla Tinoco, Marisol Pina-Gonzales, Humberto Barrios, Jesús Martínez-Barnetche, Rosa elena Gomez-Barreto, Juan Tellez. BMC Microbiol. 2015 Dec;15(1):396. Download


SUBMISSIONS

In order to function as such a resource and to maintain the quality of the data, the databases are hand curated, and all entries will be checked before final entry into the main database.

To submit your data please contact the curator directly.

email: ulises.garza @insp.mx
INSTITUTO NACIONAL DE SALUD PÚBLICA, MÉXICO - DERECHOS RESERVADOS © 2018
Av. Universidad No. 655 Colonia Santa María Ahuacatitlán, Cerrada Los Pinos y Caminera C.P. 62100, Cuernavaca, Morelos. México. Tel. (777) 329 3000
Contact: webmaster_kv@ insp.mx